ID: 971462978

View in Genome Browser
Species Human (GRCh38)
Location 4:26922684-26922706
Sequence CAGTTTTCCTGGAGGTCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971462974_971462978 3 Left 971462974 4:26922658-26922680 CCTTGTAACAGAGTTTTTGTAGA 0: 1
1: 1
2: 1
3: 8
4: 220
Right 971462978 4:26922684-26922706 CAGTTTTCCTGGAGGTCAGTGGG No data
971462973_971462978 27 Left 971462973 4:26922634-26922656 CCTGGAAGCTCTTTGAATCTTGA 0: 1
1: 0
2: 3
3: 20
4: 225
Right 971462978 4:26922684-26922706 CAGTTTTCCTGGAGGTCAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971462978 Original CRISPR CAGTTTTCCTGGAGGTCAGT GGG Intronic
No off target data available for this crispr