ID: 971465999

View in Genome Browser
Species Human (GRCh38)
Location 4:26961671-26961693
Sequence TCACTATTATACACAGAAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 127
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 120}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971465999 Original CRISPR TCACTATTATACACAGAAGG TGG Intronic
903916456 1:26768111-26768133 TCAATATTAGACTCAGAAAGCGG - Intronic
904895973 1:33818808-33818830 TCATTATTATACTGAGAAAGGGG - Intronic
905677783 1:39841206-39841228 TCAGAATTCTACAGAGAAGGAGG - Exonic
906243133 1:44254602-44254624 TCATTCTTATATACAGAAAGTGG + Intronic
908464578 1:64379580-64379602 TCAAAATTATTAACAGAAGGTGG - Intergenic
909474880 1:76071654-76071676 TCATTCTCATGCACAGAAGGTGG + Intergenic
909794192 1:79712702-79712724 TCATTATTATATACTGAAGCTGG + Intergenic
911412197 1:97523806-97523828 TCCCTTTTTTACACATAAGGAGG - Intronic
914373563 1:147051944-147051966 TCACTCTTATCCAGAGCAGGAGG + Intergenic
916528898 1:165637244-165637266 GCAATATCATACACAGAAGTAGG + Intronic
917076714 1:171213794-171213816 TTACTATTCTACAGAGATGGCGG + Intergenic
917412962 1:174779214-174779236 TCAGTATTATACAAAGAAAAGGG - Intronic
918869585 1:189951721-189951743 ACAATTTTATAGACAGAAGGTGG + Intergenic
923385034 1:233457469-233457491 TTATTATTATATACAGAGGGTGG - Intergenic
1069357568 10:67605026-67605048 TCAGTGTTATACCCAGAAGAGGG - Intronic
1074661068 10:115658467-115658489 TCATAATTATCCACAGAAGAAGG - Intronic
1074928749 10:118101805-118101827 TTACCATTAAACACTGAAGGCGG + Intergenic
1074941909 10:118244650-118244672 TCATTATTTTAAACAAAAGGAGG - Intergenic
1074958376 10:118415241-118415263 TCACTTTCACACAAAGAAGGAGG + Intergenic
1080021452 11:27564604-27564626 TTACTATTATCCAAAGAAGAGGG - Intergenic
1080569124 11:33540540-33540562 TTGCAATTTTACACAGAAGGTGG - Intergenic
1084293078 11:68188713-68188735 GCACTATGATACACAAAAGGAGG + Intronic
1085362339 11:75901534-75901556 TCACTAAGAAACACAGCAGGAGG - Intronic
1086168368 11:83806825-83806847 TCACTATTAGACACTGAAATTGG - Intronic
1091783155 12:3226467-3226489 TCAGCATTTTACCCAGAAGGAGG - Intronic
1092073561 12:5653979-5654001 TTAGTATTATACACAGCAGCAGG + Intronic
1095270130 12:40208849-40208871 TCCTTATTTTACACAGAAGTGGG + Intronic
1099929475 12:89057571-89057593 TCACCCTTAGACCCAGAAGGAGG + Intergenic
1102671115 12:114619802-114619824 TTACTATTTTACAGATAAGGAGG - Intergenic
1105071037 12:133234948-133234970 ACACTTTTATTCACAGAAGTAGG + Exonic
1109695173 13:65946096-65946118 TCACTAATAACCACAGAAAGTGG - Intergenic
1111233762 13:85380556-85380578 TTGCAATTATTCACAGAAGGAGG + Intergenic
1112382884 13:98909691-98909713 GCACTATTATACAAAGGAGCTGG - Intronic
1115859824 14:37671816-37671838 TCACTATCATGAACAGAATGAGG - Intronic
1118377460 14:65189673-65189695 TTACAATTATACACGGTAGGTGG + Intergenic
1121826473 14:97013838-97013860 TCTCTTTTGTACACAGAAGGTGG + Intergenic
1125549212 15:40532170-40532192 TCATTATTATACACAGGATCTGG + Intronic
1129294461 15:74592246-74592268 TCAGGAATATAGACAGAAGGAGG + Intronic
1138328839 16:56196141-56196163 TCACAATCACACACACAAGGGGG - Intronic
1143815791 17:9513551-9513573 GAACTCTTATACACAGATGGTGG + Intronic
1147224259 17:38964153-38964175 TAGCTATTATTAACAGAAGGTGG - Intronic
1149499701 17:57142960-57142982 TCCCAATTTTACACTGAAGGAGG + Intergenic
1150747856 17:67830808-67830830 TCCCTATTCTACAGAAAAGGGGG - Intronic
1150944493 17:69730347-69730369 TCACTAGTCTCCAGAGAAGGTGG + Intergenic
1151274875 17:73026809-73026831 TCACTGTTTTAAACTGAAGGCGG + Intronic
1153650103 18:7231891-7231913 TCACCAGTCTACACAGCAGGTGG - Exonic
1155592544 18:27444475-27444497 TCACCATTCTACCTAGAAGGTGG - Intergenic
1155925903 18:31654984-31655006 GCTCTATTATTCAAAGAAGGAGG + Intronic
1167915767 19:52739208-52739230 TGCCTATTATACACAGAAGGTGG - Intergenic
1167941018 19:52945998-52946020 TGCCTATTACACACAGGAGGTGG - Intronic
930190192 2:48450816-48450838 TCACCATTTTACAGATAAGGAGG - Intronic
933280123 2:80323683-80323705 TCACTAATAGAAAAAGAAGGAGG - Intronic
935661542 2:105470981-105471003 TCACAATGAAAAACAGAAGGAGG - Intergenic
935724876 2:106015111-106015133 GGACTATGAGACACAGAAGGAGG + Intergenic
935869886 2:107435880-107435902 TATCTATTTAACACAGAAGGAGG - Intergenic
941351044 2:164436830-164436852 TCCCTCTTTTACACAGATGGTGG - Intergenic
942431761 2:175919444-175919466 GCACTGTTAAAAACAGAAGGTGG + Intergenic
944996321 2:205298412-205298434 TCACTATTAAATCCAGAAAGAGG - Intronic
946348187 2:219128462-219128484 TATCTATTGTACCCAGAAGGGGG - Intronic
1170452678 20:16501209-16501231 GCACTTTTATACACTGATGGTGG + Intronic
1170902054 20:20473639-20473661 TCTCTATTAAAAACAGAAGCTGG - Intronic
1181835423 22:25603314-25603336 TCTCTATTATCCACTGATGGTGG - Intronic
1203245448 22_KI270733v1_random:64588-64610 TCTCTCTTATCCTCAGAAGGAGG - Intergenic
951268179 3:20594448-20594470 ACACTATTGTACAAAGAAAGAGG - Intergenic
951271895 3:20635423-20635445 TCACTATAAGAAACAGATGGGGG - Intergenic
951634912 3:24763211-24763233 TCAGTATTATGGACAAAAGGAGG + Intergenic
954041969 3:47895126-47895148 TGACTAGTTTACACAGAATGGGG - Intronic
957244377 3:77699275-77699297 TCAGTGTTATCCACAGAATGGGG - Intergenic
964560541 3:157990631-157990653 ACACAATTATACTAAGAAGGAGG + Intergenic
966191550 3:177276338-177276360 TCACTTTTATTCACTGGAGGAGG + Intergenic
966442863 3:179965933-179965955 TAAATATTGTACACAGAAGGGGG - Intronic
967542621 3:190685001-190685023 TCAACATTATACAGAGGAGGAGG - Intergenic
967694081 3:192511142-192511164 TCATAACTATACACAGAAGGAGG + Intronic
971465999 4:26961671-26961693 TCACTATTATACACAGAAGGTGG + Intronic
971599946 4:28580164-28580186 TCACTGCCATAGACAGAAGGTGG + Intergenic
973149068 4:46865115-46865137 TTAATATAATACTCAGAAGGGGG - Intronic
975894538 4:79072819-79072841 GAACTATTATACACACAATGTGG - Intergenic
977704590 4:100057138-100057160 TCATTCTTATACACAGACTGAGG + Intergenic
980627542 4:135392303-135392325 TCAATATTAAAAACAGCAGGAGG - Intergenic
980631280 4:135438389-135438411 TCAATATGATACACAGATGTTGG + Intergenic
980733702 4:136855105-136855127 TCACTATGATCCCCAGCAGGGGG + Intergenic
982788137 4:159559638-159559660 TGACTGATATCCACAGAAGGGGG + Intergenic
988433223 5:31144231-31144253 TTACTATTTTATAAAGAAGGAGG + Intergenic
989417524 5:41197551-41197573 TCACTTTGTTAGACAGAAGGAGG + Intronic
990865677 5:60377208-60377230 TCACTATTTTACACACTATGAGG + Intronic
993575704 5:89597698-89597720 TCATTATTACACAAAGGAGGTGG + Intergenic
994643584 5:102441254-102441276 TCACTTTTATACATAATAGGAGG + Intronic
995095197 5:108227880-108227902 TCACTATTAAAAACAAAAAGGGG + Intronic
995121052 5:108535764-108535786 ACATTATTATTCACAGAAGAGGG - Intergenic
995258970 5:110079403-110079425 TCACATATATACACAGAAGTGGG - Intergenic
998025941 5:138816486-138816508 ACACTCTTATACACTGATGGTGG - Intronic
999582285 5:153052299-153052321 TGACAATTATTAACAGAAGGAGG + Intergenic
1002347116 5:178555804-178555826 TCACTACTGTTCACAGACGGTGG + Intronic
1003771500 6:9307139-9307161 TCTCTTTTATACAGAGCAGGAGG + Intergenic
1005116966 6:22349495-22349517 TGAGTATTTTACCCAGAAGGTGG + Intergenic
1005157245 6:22820566-22820588 TCACTGTCATACACAAAAGTGGG + Intergenic
1009927923 6:70142613-70142635 TCAGTATTATACAGATAAAGTGG + Intronic
1010207072 6:73332482-73332504 TCCCTTTTATACCCACAAGGTGG - Intergenic
1011855674 6:91687546-91687568 TCATTATTGTACACAGATGGAGG - Intergenic
1013411762 6:109889531-109889553 TAGCTATTATACACTGCAGGGGG - Intergenic
1016052730 6:139547222-139547244 TAACTGTTAGAAACAGAAGGTGG - Intergenic
1016094242 6:140016466-140016488 TCTTTATTATGCACAGAACGAGG - Intergenic
1017472984 6:154758705-154758727 TCTCTATTATCCAAAGAAGAGGG - Intronic
1018174761 6:161168895-161168917 TCCCTACTTTACAGAGAAGGGGG - Intronic
1020225807 7:6279087-6279109 TCATTGTTATCCACAGAAGTAGG + Intergenic
1020705134 7:11534708-11534730 ACAATATTTTACAGAGAAGGTGG + Intronic
1020717915 7:11700994-11701016 AAACTAGTATACAAAGAAGGAGG - Intronic
1031441413 7:121799341-121799363 TCACTATTATAAAGAGGGGGGGG - Intergenic
1036095193 8:5716487-5716509 TCACTATTAGATCCCGAAGGCGG + Intergenic
1041774723 8:61511510-61511532 TAATTATTATACTCAGGAGGTGG - Intronic
1049018931 8:139940835-139940857 TCACTCTTCCACACAGAGGGAGG + Intronic
1050470184 9:5980128-5980150 TCATCATTATAAACAGAATGTGG + Intronic
1051034287 9:12724623-12724645 TAACTATTAGAGACAGTAGGAGG + Intergenic
1051248066 9:15131874-15131896 AAACTATTAAACACAGATGGAGG + Intergenic
1055939102 9:81632375-81632397 CTACTATTCTACACAGAAGAGGG + Intronic
1057614888 9:96580537-96580559 CTACTTTTATACAAAGAAGGTGG + Intronic
1057760156 9:97866460-97866482 TCACTTTTATACAATGAAGAGGG - Intergenic
1061154125 9:128846853-128846875 TCACTATTGACCACAGCAGGTGG - Intronic
1185470718 X:381097-381119 TTACTATTTTACAGAGATGGGGG + Intronic
1185489155 X:507562-507584 TCCCAGTTAAACACAGAAGGAGG - Intergenic
1187822475 X:23302692-23302714 TCAATCTTGTACAAAGAAGGAGG + Intergenic
1190195603 X:48315627-48315649 GCACGATTTTACTCAGAAGGGGG + Intergenic
1190662053 X:52663839-52663861 GCACGATTTTACTCAGAAGGGGG + Intronic
1191963682 X:66731607-66731629 TACCTATAATCCACAGAAGGGGG - Intergenic
1194968084 X:100312407-100312429 TGACAAGTAAACACAGAAGGTGG - Intronic
1199662121 X:150062337-150062359 TCATTTTTATACAAAGCAGGAGG + Intergenic
1199924175 X:152445163-152445185 TCCTGAATATACACAGAAGGGGG - Intronic