ID: 971469673

View in Genome Browser
Species Human (GRCh38)
Location 4:27008872-27008894
Sequence CAGAATAAAGGGAAGAGGTC AGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 447
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 416}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971469673_971469679 -8 Left 971469673 4:27008872-27008894 CCTGACCTCTTCCCTTTATTCTG 0: 1
1: 0
2: 2
3: 28
4: 416
Right 971469679 4:27008887-27008909 TTATTCTGATCACAGCTGGGTGG 0: 1
1: 0
2: 1
3: 13
4: 153

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971469673 Original CRISPR CAGAATAAAGGGAAGAGGTC AGG (reversed) Exonic
902258452 1:15206253-15206275 GAGAAGAAAGGGAAGAGGAGGGG + Intronic
902984546 1:20147784-20147806 GTGATTGAAGGGAAGAGGTCTGG + Intronic
904186299 1:28707744-28707766 TGGAATACAGGAAAGAGGTCAGG + Intronic
904324247 1:29717520-29717542 CAAAATAAAGGGATGGGCTCTGG + Intergenic
904543147 1:31247609-31247631 CAAGAAAAAGGGAAGAGGTTAGG + Intergenic
904548949 1:31298919-31298941 CAGAAGAAAGGAAGGAGGACTGG + Intronic
904566905 1:31433729-31433751 CAGAATCAAGGGTAGCGGTCAGG + Intronic
905298749 1:36971813-36971835 CAGAAGAAAAGGAAGGTGTCAGG - Intronic
906439377 1:45827579-45827601 CAGAATGAAGGAAAGAAGGCAGG + Intronic
906968278 1:50482157-50482179 CAGAATAAAGATTAGAGGTTAGG - Intronic
907420073 1:54341319-54341341 CACATTAAAGGGGAGACGTCTGG - Intronic
908942574 1:69453674-69453696 CATGATAAAAGGAAGAAGTCTGG + Intergenic
910127479 1:83860402-83860424 AGGAATAAAGGATAGAGGTCAGG - Intergenic
910212960 1:84812726-84812748 AAGAATCAAGGAGAGAGGTCAGG - Exonic
910875253 1:91872624-91872646 CAGAAACAAGGCAAGATGTCAGG + Intronic
910997637 1:93125545-93125567 CAGAATCAAGAGAAAAGATCTGG + Intronic
911615947 1:100010941-100010963 CATAATAAAGGGAAGCTGTTGGG - Intronic
912152292 1:106875173-106875195 CAGAAACTAGGGAAGAGGTAAGG - Intergenic
912720483 1:112015884-112015906 AAGAGTTCAGGGAAGAGGTCTGG - Intergenic
912958339 1:114172384-114172406 TGGAATTCAGGGAAGAGGTCAGG + Intergenic
913304781 1:117416721-117416743 AAGAACAATGGGAAGAGGTTGGG + Intronic
914955806 1:152161113-152161135 AGGGATAAAGGGATGAGGTCTGG + Intergenic
915504277 1:156343312-156343334 CAGAATAATGGGAAGAAGAGCGG + Intronic
915932562 1:160069466-160069488 CAGAATAGAAGGAAGAGATTGGG + Intronic
916451785 1:164927940-164927962 AAGAGAAAAGGGAAGAGGCCGGG - Intergenic
916826161 1:168444000-168444022 AAGAATAAAGGGGAGAAGCCAGG + Intergenic
918082239 1:181216711-181216733 CTGAATAACTGGAAGAGCTCAGG - Intergenic
919423283 1:197398668-197398690 CATAAGAAAAGGAAGAGGTTTGG + Intronic
919473327 1:198005559-198005581 CAGAATCTAGGGAAGAGGCATGG + Intergenic
919800086 1:201348600-201348622 CACAATTAAGGGAAAAGGACAGG + Intergenic
919864966 1:201774270-201774292 AAGAATAAAGTAAAGAGGACAGG - Intronic
919881577 1:201904546-201904568 TAGGATAAAGGGGAGAAGTCAGG - Intronic
921038794 1:211409014-211409036 AAAAATAAAGAGAAGAAGTCTGG + Intergenic
921918557 1:220641599-220641621 CAAAATAAAGGGAAGAAGGAAGG + Intronic
922012296 1:221601635-221601657 TAAAAGAAATGGAAGAGGTCAGG + Intergenic
922074867 1:222233596-222233618 CAAAAGAAAGGGAAAACGTCAGG - Intergenic
923699650 1:236287772-236287794 CAGAAAAAAGGGACGAGGAAGGG - Intergenic
923848763 1:237768865-237768887 CAGAACAATGGGAAGAGGGGAGG - Intronic
924073513 1:240308510-240308532 CAGAAAAGAGGGACGAGGACGGG + Intronic
924236734 1:242005341-242005363 AAGAATAAAGGTCAGAGGACAGG - Intergenic
1065082272 10:22140313-22140335 CAGAGGAAAGGGAAGAGTGCAGG + Intergenic
1065286805 10:24194480-24194502 GAAAATAAAGGCCAGAGGTCAGG - Intronic
1065542882 10:26787581-26787603 CAAAAAAAAGGGAACAGGTTTGG + Intronic
1066542000 10:36457486-36457508 CGAAATAAAGGGATGAGCTCTGG - Intergenic
1067522509 10:47018981-47019003 CAGAAAAATGGAAGGAGGTCAGG + Intergenic
1067727994 10:48787445-48787467 CAGAGCAATGGGACGAGGTCAGG + Intronic
1068300597 10:55133564-55133586 CAGAAATCAGGAAAGAGGTCAGG - Intronic
1068420742 10:56788994-56789016 CAGAAAAAAGAAAAGAGGCCAGG - Intergenic
1069073137 10:64010712-64010734 TAGAATAGAGGGAGGGGGTCAGG - Intergenic
1069740154 10:70682208-70682230 CAGAAGAAAGAGAAGAGGACCGG + Intronic
1070541679 10:77419890-77419912 AAGAAGAAAGTGAAGAGGTCAGG + Intronic
1070650016 10:78228596-78228618 CAGATTCAAGGGGACAGGTCTGG - Intergenic
1073028811 10:100508479-100508501 CAGAAGAAAGAGAAAAGGCCAGG + Intronic
1074096980 10:110322458-110322480 CAGCAGAAAGAGAAGAGATCAGG - Intergenic
1074172670 10:110958636-110958658 TAGAATAAAGGAGGGAGGTCTGG - Intronic
1074471398 10:113730212-113730234 GAGGATAATGGGAAGAGGTTTGG + Exonic
1074596353 10:114871456-114871478 CAGAACAAAGGGAAGAGGCTGGG - Intronic
1076620087 10:131781404-131781426 CAGAAGGAAGGGAAGAGGCAGGG + Intergenic
1077818251 11:5709283-5709305 CTGAATAAAAGGAAGAGCTCTGG + Exonic
1078419929 11:11202093-11202115 CACAATAAAGGCAAAAGGTTAGG + Intergenic
1079418438 11:20262979-20263001 GAGAATAAATGAAAGAGGCCAGG + Intergenic
1079789690 11:24720972-24720994 GAAAATAAAGAGAACAGGTCTGG - Intronic
1080059053 11:27937584-27937606 CAGAAGAAAAGGAAGAGCACTGG + Intergenic
1080962807 11:37180268-37180290 CAGAATAAAGATAAAAAGTCTGG - Intergenic
1081188417 11:40073742-40073764 CAGTATAAAGGGGATTGGTCAGG - Intergenic
1081280903 11:41208608-41208630 CAGAATAAAAGAAAGCTGTCAGG + Intronic
1081522505 11:43896705-43896727 CTAAATAATGGGAAGAAGTCAGG - Intronic
1082037189 11:47654476-47654498 AAGAACAAAGGAAAGAGGGCGGG + Intergenic
1082207235 11:49452408-49452430 CAGAAGAAAAGGAAGCAGTCTGG - Intergenic
1082757916 11:57096455-57096477 AAGAAAAAAGAGAAGGGGTCTGG - Intergenic
1082899552 11:58231248-58231270 CAGAATAAATTGAAGAAGTTAGG + Intergenic
1083649571 11:64193785-64193807 CAAAAAAAAAGGAAGAGGCCCGG + Intronic
1083976022 11:66120975-66120997 CACAATAAAAGGAGGAGGTAGGG - Intronic
1084061010 11:66674525-66674547 CTGAATAAAAGGAAAAGGACAGG - Intronic
1084723889 11:70927852-70927874 TAGAACAAAGGGAAGAGGAAGGG + Intronic
1085182981 11:74551676-74551698 GGGAATAAAGGGAAGAGGATAGG - Intronic
1085263658 11:75223826-75223848 CAGAGGGAAGGGAAGAGGTTTGG - Intergenic
1086436659 11:86788012-86788034 TGGAATAATTGGAAGAGGTCTGG - Intergenic
1086446256 11:86874113-86874135 AAGAATAAAGGGGAAAGGTTGGG + Intronic
1086648041 11:89249325-89249347 CAGAAGAAAAGGAAGCAGTCTGG + Intronic
1087013389 11:93533815-93533837 AACATTAAAGAGAAGAGGTCAGG - Intronic
1088250111 11:107855206-107855228 ACCAATAAAGGGAAGAGTTCAGG + Intronic
1089111901 11:116063801-116063823 CAGAATCCAGGGGAGAGGTGTGG - Intergenic
1089113926 11:116078765-116078787 CAGAAAAGAGGGAAGAGGGAAGG + Intergenic
1089115109 11:116088492-116088514 CAGAAGAAAGGAAAGAGATAAGG + Intergenic
1089147043 11:116336679-116336701 CTGAATAAAGGGAAGGGAGCTGG - Intergenic
1089622595 11:119730126-119730148 CAGAGTAAGGGGAAGAGGGAAGG - Intergenic
1090266151 11:125354128-125354150 AAAGATAAAGGGAAGAAGTCAGG - Intronic
1090517405 11:127443785-127443807 CAGATGAAAGGGAACAGGGCAGG - Intergenic
1091070403 11:132557674-132557696 TAGAATATAGGGAAGTGCTCAGG - Intronic
1091857638 12:3752494-3752516 CAGAGCAAAGGAAGGAGGTCAGG - Intronic
1092278756 12:7082999-7083021 CAGAAAAAAGGGAAAAAATCTGG - Intronic
1092380147 12:7989209-7989231 AAGAATTAAGGGAAGAGGTGTGG - Intergenic
1093564925 12:20590612-20590634 CAGAAGAAAGGAAAGAGGAAAGG + Intronic
1093675950 12:21941025-21941047 TAGAATTAAGGGACGAGGCCCGG - Intronic
1095128557 12:38510284-38510306 CAAAATAAAGGGATGGGGCCAGG + Intergenic
1095363235 12:41369892-41369914 CTGAATCATGGGAATAGGTCTGG - Intronic
1098432868 12:70439420-70439442 AAGCATAAAGGGATGAGGTTGGG - Intergenic
1099871922 12:88360265-88360287 CAGAATAAATGGAGGAGGACAGG - Intergenic
1100410006 12:94306918-94306940 CAGAATAAAGGTGAGAGGTCTGG + Exonic
1102159575 12:110757571-110757593 CAGAAAAATGGGAAGGGGGCTGG - Intergenic
1102295695 12:111734925-111734947 TAGAATTAAGGGAAGACGGCCGG + Intronic
1103143300 12:118571146-118571168 CAAAGTAAAGGGATGAGCTCTGG - Intergenic
1103583952 12:121937205-121937227 CAGAAGCAAGGGGAGAGGCCTGG - Intronic
1103887900 12:124216563-124216585 GAGAATAAAAAGAAAAGGTCTGG - Intronic
1103969792 12:124663398-124663420 CAGAAGCTAGGGAAGAGGCCAGG - Intergenic
1104810669 12:131618318-131618340 CTTAATAAAGGGCAGGGGTCGGG - Intergenic
1105902596 13:24768978-24769000 AAAAAAAAAGGGAAGAGGTTAGG - Intronic
1107049461 13:36031963-36031985 GAGAAAAAAGGGAAGGGGACAGG + Intronic
1108438270 13:50422693-50422715 CAGGACAAAGGGCAGAGCTCAGG + Intronic
1109264035 13:60176206-60176228 AAATATAATGGGAAGAGGTCAGG - Intergenic
1109525580 13:63570464-63570486 CAGAACTAAGGAAAGTGGTCAGG - Intergenic
1109610684 13:64761362-64761384 CAAAACAAAGACAAGAGGTCTGG + Intergenic
1110151477 13:72260070-72260092 CAGAGTCAAGGGTAGAGGCCTGG + Intergenic
1110596283 13:77324111-77324133 CAGAATAGAGGGATGTGGTGAGG - Intronic
1112155729 13:96815190-96815212 CAGACGAAAGAGAAGAGGCCTGG - Intronic
1112454384 13:99545429-99545451 CATACTAAAGAGAATAGGTCAGG + Intronic
1113345072 13:109469210-109469232 CACAATAAATGAAAGAGCTCAGG - Intergenic
1114255729 14:20999922-20999944 CAGGACAAAGGGAAGAGAGCGGG + Intronic
1114441241 14:22750048-22750070 GGGAACAAAGGGAAGAGGCCAGG + Intergenic
1114628576 14:24145493-24145515 TAGGATGAAGGGAAGAGGTTGGG - Intronic
1114915403 14:27258127-27258149 CACAAGAAAAGGAAGAGGACTGG - Intergenic
1115029238 14:28774673-28774695 AAGAAGAAAGGGAAAAGGTAGGG - Intronic
1115975254 14:38990151-38990173 CAGAAAAGAGGGAAGAGGAAAGG - Intergenic
1116238770 14:42313916-42313938 CAAAATAAAGGGATGGGCTCTGG + Intergenic
1117084453 14:52185040-52185062 CAGGACAAAGGGAGGAGGACAGG + Intergenic
1117373354 14:55098842-55098864 CAGAAGAAAGGAAAGAAGTATGG + Intergenic
1117460247 14:55938277-55938299 CAGACAGAAGGGAAGAGGGCTGG - Intergenic
1117631173 14:57693533-57693555 CAAAATAAAGGGATGGGCTCTGG - Intronic
1117804836 14:59480958-59480980 TACAATCAAGGGAAGAGGGCAGG - Intronic
1119715775 14:76858276-76858298 CAGAAGCCAGGGGAGAGGTCAGG - Intronic
1120390483 14:83901153-83901175 AAGAATAAAGGGAAGAAATTTGG + Intergenic
1120678448 14:87450588-87450610 CAGAATAAAGGAGATAGGTGTGG - Intergenic
1120696522 14:87650906-87650928 CAGAATGAAGGGAAGAAGAAGGG - Intergenic
1122948777 14:105028938-105028960 AAGAATGAAGGGAAAAGGTTAGG - Intergenic
1124108077 15:26759681-26759703 CAGATCAAAAGGAAGAGGACAGG - Intronic
1125775103 15:42205561-42205583 CAGAAGACAGGGAAGAAATCAGG + Intronic
1129039132 15:72670687-72670709 CAGCATAAAGGTAACAGGCCTGG - Intergenic
1129074725 15:72983786-72983808 TAAAATAAAGGAAAGCGGTCAGG - Intergenic
1129399644 15:75274537-75274559 CAGCATAAAGGTAACAGGCCTGG - Intronic
1130543493 15:84838915-84838937 CAAAATAATGGGAAGAGGCCGGG - Intronic
1131189284 15:90301085-90301107 CAGCATACAGGTAACAGGTCTGG - Intronic
1131199730 15:90386848-90386870 AAGAATAAACGGAAGAGGGCCGG + Intergenic
1132367631 15:101269099-101269121 CTGACTAAGGGGAAGAAGTCAGG - Intergenic
1133141232 16:3746224-3746246 CAGATTAAGGGGACGAGGGCAGG - Intronic
1133621030 16:7526499-7526521 AAGAAAAAAGGGAGGAGATCTGG - Intronic
1134182800 16:12061345-12061367 GAGAACAAATGCAAGAGGTCTGG + Intronic
1136392626 16:29974814-29974836 CACAATGAAGGGAAGAGGAAGGG - Intronic
1136659126 16:31739944-31739966 CAAAATAAAGGGATGGGCTCTGG - Intronic
1138395287 16:56699513-56699535 AAAAATAAAGGGAATAGGCCAGG + Intronic
1138901491 16:61275892-61275914 GAGAATAAAGGAAATAGTTCAGG - Intergenic
1139007743 16:62594033-62594055 AAGAAGAAAGGGAAGAGGCCGGG + Intergenic
1139008793 16:62607212-62607234 CAGAAGAGAGGGAAGAGGAGAGG - Intergenic
1139761027 16:69185090-69185112 CAAAACAAAGGGCAGAGGTAGGG + Intronic
1140348348 16:74236806-74236828 AAAAACAGAGGGAAGAGGTCAGG + Intergenic
1140709663 16:77664994-77665016 CAGAATGAACAGCAGAGGTCTGG - Intergenic
1140754096 16:78051984-78052006 CAGAATAAGGGGAAGATCCCTGG + Intronic
1143363263 17:6388397-6388419 CAGATGAAAAGGAAGGGGTCAGG + Intergenic
1146015472 17:29229679-29229701 CAGAAGAAAGGAGGGAGGTCTGG + Intergenic
1147136747 17:38438475-38438497 CAGAATAGAGGGAGGAGGTCAGG + Intronic
1148186504 17:45648494-45648516 CAGAAGAAAGAGAAGAAGTGTGG - Intergenic
1148655847 17:49282787-49282809 CAGAATCTAGGGAAGAGGCATGG + Intergenic
1149344305 17:55718772-55718794 CAGATAAAAGGGAAGACTTCCGG + Intergenic
1149364507 17:55928814-55928836 CAGACTTCAGGAAAGAGGTCAGG + Intergenic
1151084952 17:71369547-71369569 CAGAATAAAAGGAAGTGTCCTGG - Intergenic
1203167345 17_GL000205v2_random:110025-110047 CAGAATAAAAAGAAGAGGGTTGG - Intergenic
1154075176 18:11193213-11193235 CAAAGTAAAGGGAAGGGGCCAGG - Intergenic
1154206841 18:12344742-12344764 CAGAATAAAAGCAAAAGGTCAGG + Intronic
1156755567 18:40520406-40520428 CAGAATAAATGGAAAATGTCTGG - Intergenic
1157900281 18:51508537-51508559 CAGAATTAAAGGAATAGGTTAGG + Intergenic
1158262127 18:55618880-55618902 CAAAATAAAGAATAGAGGTCAGG - Intronic
1158827128 18:61235273-61235295 CAGAAGCGAGGGAAGAGGTGTGG - Intergenic
1159908722 18:74123047-74123069 AAGAAAGAAGGGAAGAAGTCTGG + Intronic
1160379341 18:78439642-78439664 CAGGACAAAGGGAAGAGGGTGGG + Intergenic
1161637176 19:5396262-5396284 CAGAAGGAAGGAAAGAGGACTGG + Intergenic
1164629114 19:29749751-29749773 AAGAATAAAGGGAAGAAGAAAGG - Intergenic
1165188206 19:34039959-34039981 CAGAATTCAAGCAAGAGGTCAGG - Intergenic
1165409589 19:35651148-35651170 CAGGATCAATGGAAGAGGGCAGG - Intronic
1165807642 19:38591027-38591049 CATAAGAAAGAGAAGAGGCCGGG + Intronic
1166392799 19:42419389-42419411 CAGGACAAAGGGCAGAGCTCTGG - Intronic
1166641985 19:44501051-44501073 CAGAGAAAAGGGGAGAGGTGGGG - Intergenic
1167122591 19:47527689-47527711 AAGAAAAAAAGGATGAGGTCAGG - Intronic
1167533348 19:50032775-50032797 CAGAACACAGGGGAGAGGCCTGG - Intronic
1167558391 19:50210237-50210259 CAGAAGTATGGCAAGAGGTCTGG + Intronic
1168725519 19:58579576-58579598 ATGAACAAAGGGAAGAGGTTGGG + Intergenic
925804266 2:7632678-7632700 CAGATTCCAGAGAAGAGGTCTGG - Intergenic
926126661 2:10276552-10276574 CAGGATGCAGGAAAGAGGTCTGG - Intergenic
926774778 2:16411136-16411158 CAGAATCTAGGGCAGAGGCCAGG - Intergenic
927169735 2:20359009-20359031 CAGAAAAAAAGAAAGAGGACTGG - Intergenic
927250138 2:20989533-20989555 GAAAAGAAAGGGAAGGGGTCTGG + Intergenic
927618724 2:24628330-24628352 CAGAATAATGGCACGAGGTGGGG - Intronic
927681005 2:25138969-25138991 AAGAAGATTGGGAAGAGGTCGGG + Intronic
930355026 2:50307275-50307297 CTAAATAAAAGGAAGAGGCCGGG - Intronic
930590572 2:53321973-53321995 CAGAGTAAAGAGAAGAAGTGTGG - Intergenic
931868197 2:66433808-66433830 GAGAATAAAGAGAAGGGGTGAGG + Intronic
933578534 2:84098555-84098577 CAGAATAAATTGTAGAGGTCAGG - Intergenic
935163386 2:100548582-100548604 CAGAAAAAAGGGATGAGGAAGGG - Intergenic
936664440 2:114577824-114577846 GATAATAAAGGCAAGAGATCAGG - Intronic
937103743 2:119291482-119291504 CAGAAGAAAGGGGATATGTCAGG + Intergenic
937531737 2:122837281-122837303 AAGAATAAAGAGAAGACATCAGG + Intergenic
937610268 2:123852835-123852857 CAGAATTAAAGGAATAGGTTGGG - Intergenic
938779059 2:134568226-134568248 AAGAATAAAGGAAAGAAGGCAGG + Intronic
939120188 2:138107221-138107243 CAGAATATAGAGATGAGGTTTGG + Intergenic
939669737 2:144995454-144995476 AAGAATAAGGGGAAAAGGCCGGG - Intergenic
940448177 2:153803395-153803417 CATAAGAAAAGGAACAGGTCTGG + Intergenic
942070691 2:172312919-172312941 CAGAACAAAGGGCAGACTTCAGG + Intergenic
942134009 2:172907333-172907355 CAGAATAGAGGGAAGAGGGAAGG - Intronic
943413372 2:187566868-187566890 CAGAATAAAGGAAAGAGAATAGG + Intergenic
943705033 2:191025565-191025587 CTGAATAACGGGCAGAGGTTTGG + Intergenic
943719710 2:191191073-191191095 CAGAAAAAAGGGAAGTCTTCAGG + Intergenic
944288936 2:197982480-197982502 CAGACAGAAGGGAAGAGATCGGG - Intronic
944809956 2:203318285-203318307 CATAATAAAGAGAAAAGGCCGGG + Intergenic
945227076 2:207542854-207542876 CAGAATAAAGGGAAGGCCTGAGG - Intronic
945454155 2:210030168-210030190 AAGAATAAAGGGATGAGATGAGG - Intronic
945614822 2:212054353-212054375 TAGGATAAAAAGAAGAGGTCTGG + Intronic
947161187 2:227216425-227216447 CAGAATAAAGAGATGCGGTAAGG - Intronic
947965733 2:234279978-234280000 CAGGCTGCAGGGAAGAGGTCAGG + Intergenic
947977112 2:234376289-234376311 AAGAATAAAGGGAAGAAGGGAGG - Intergenic
1169037802 20:2467938-2467960 CAGATTACTGGGTAGAGGTCAGG - Intronic
1169221718 20:3827060-3827082 GAGAAGAAAGGGAAGAGGCTTGG - Exonic
1169359637 20:4937213-4937235 CAGATAAAAGGGGAGAGGTGAGG + Intronic
1169646042 20:7811013-7811035 CAAAATAAAGGGATGAAGTGTGG - Intergenic
1169810119 20:9601327-9601349 CAGAATGGGGGAAAGAGGTCAGG + Intronic
1170929187 20:20753562-20753584 AAGAGGAAAGGGAAGATGTCGGG - Intergenic
1171974278 20:31584186-31584208 AAATATAAAGGGGAGAGGTCTGG - Intergenic
1173053016 20:39583661-39583683 AAGAAGAAAGGGAAGAGGAAAGG + Intergenic
1173476722 20:43364901-43364923 AAGAACACAGGGAAGAGGTCTGG - Intergenic
1173778413 20:45732177-45732199 GAGAAGAAAGGGAAAAGGTAAGG - Intergenic
1173889974 20:46499244-46499266 CAGAAGCTAGGGAAGAGGCCTGG + Intergenic
1174234658 20:49079521-49079543 CATAAGAAAGGGTAGAGGCCAGG - Intronic
1174389911 20:50212628-50212650 CAGAATCAAGGGATGGGGCCAGG - Intergenic
1174581720 20:51576940-51576962 CAGAAGAAGGGGAAGGGGTGGGG - Intergenic
1174645994 20:52085967-52085989 CAGAATGCAGGGGAGAGGTTAGG - Intronic
1174776155 20:53345087-53345109 CAGACAGAAGGGAAGTGGTCAGG + Intronic
1176334224 21:5580618-5580640 CAGAATAAAAAGAAGAGGGTTGG + Intergenic
1176393533 21:6240334-6240356 CAGAATAAAAAGAAGAGGGTTGG - Intergenic
1176404414 21:6349110-6349132 CAGAATAAAAAGAAGAGGGTTGG + Intergenic
1176432743 21:6639994-6640016 CAGAATAAAAAGAAGAGGGTTGG - Intergenic
1176467886 21:7075840-7075862 CAGAATAAAAAGAAGAGGGTTGG + Intronic
1176491447 21:7457618-7457640 CAGAATAAAAAGAAGAGGGTTGG + Intergenic
1176509195 21:7680765-7680787 CAGAATAAAAAGAAGAGGGTTGG - Intergenic
1177550102 21:22609962-22609984 CACAATAAAGGAAACAGCTCAGG + Intergenic
1177784697 21:25658650-25658672 AAGAATGAAGGGAAAAGATCAGG + Intronic
1178326038 21:31646268-31646290 TGGAAGAAAGGGAAGAGGGCTGG + Intergenic
1178570250 21:33729085-33729107 CAGGATGAAGGGATGAGGCCAGG - Intronic
1181361335 22:22339557-22339579 CAGAATAATGTGAAGAAATCTGG + Intergenic
1182347781 22:29678865-29678887 CACAATAAAGGGAAGACGGAGGG - Intronic
1183029397 22:35092089-35092111 GAGAGTTCAGGGAAGAGGTCTGG - Intergenic
1184111360 22:42397454-42397476 CACAAAAAGAGGAAGAGGTCAGG - Intronic
1185318608 22:50190019-50190041 CAGACTAGAGGGAGGAGGGCTGG + Intronic
950031719 3:9858260-9858282 AAGAATAAAGGAAGGAGGCCAGG - Intergenic
950341892 3:12254292-12254314 CAAAAGAAAGAGAAGAGGTGAGG + Intergenic
950390018 3:12689203-12689225 CAGAAAACAGGGAACAGGTTGGG - Intergenic
950489930 3:13298027-13298049 TAAAAGAAAGGGAAGAGGCCGGG + Intergenic
951179457 3:19641933-19641955 AAGAACAAAGAGAAGAGGTGGGG + Intergenic
951829858 3:26914643-26914665 CAGCATTAAGAGAAGAGATCAGG + Intergenic
952221539 3:31328426-31328448 CAGGAGAAAGGGAAGGGGGCAGG + Intergenic
952760421 3:36908671-36908693 CTGAATAAATGGAATTGGTCTGG - Intronic
953480766 3:43249922-43249944 CAGAAAAATGGGAAGACTTCAGG - Intergenic
954072234 3:48151405-48151427 GGGAAAAAAGGGAAGAGGGCTGG - Intergenic
954328991 3:49879134-49879156 CAGCATCAAGGGAAGAGGGGTGG - Intergenic
957365042 3:79212018-79212040 CAAAATAAAGGGATGGGCTCTGG + Intronic
957712629 3:83882470-83882492 CAGAATAAAGAGAAAAGACCTGG - Intergenic
958747695 3:98157394-98157416 CAAAATAGAGGGAAGGGCTCAGG - Intergenic
959198519 3:103215716-103215738 CAAAATAAAGGGATGGGCTCTGG - Intergenic
960211972 3:114980135-114980157 CATAATAAAAGGAAGGGCTCGGG - Intronic
960872114 3:122260511-122260533 CTGAATAAAGGAAAGGGCTCTGG + Intronic
963466777 3:145691966-145691988 ATGAAGAAAGGGAAGAGGACTGG - Intergenic
964197573 3:154082258-154082280 CAAAATAAAGGGATGGGCTCTGG + Intergenic
964222345 3:154361811-154361833 AAGAATAAAGATTAGAGGTCTGG - Intronic
964986549 3:162747751-162747773 CAGAATAAAGGGAAAAACTATGG - Intergenic
965437853 3:168674701-168674723 CAGAAGCTAGGGAAGAGGCCTGG - Intergenic
965590015 3:170354017-170354039 AAGTGTAAAGGGAAGAGGACAGG + Intergenic
966635000 3:182123138-182123160 CACAATAATGGAAAGAGCTCTGG - Intergenic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
967731924 3:192915148-192915170 CAGAACAAAGCCAAGAGGACTGG + Intronic
968805521 4:2769181-2769203 CTGCATAGAGGGGAGAGGTCTGG - Intergenic
969581976 4:8071070-8071092 CTGCATAAAGGGAGGAGGTGTGG - Intronic
970228923 4:13889038-13889060 AAGAATAAAGGGAAAAGGGTAGG - Intergenic
971399334 4:26261509-26261531 AAGAAGAGAGGGAAGTGGTCAGG + Intronic
971469673 4:27008872-27008894 CAGAATAAAGGGAAGAGGTCAGG - Exonic
972190514 4:36586085-36586107 CAGAGTGAAGGGAAAAGGTATGG - Intergenic
972230357 4:37065396-37065418 CAGAACAAAAGGAAAAGTTCTGG - Intergenic
972603677 4:40594543-40594565 GAGAATATAGGGTTGAGGTCCGG - Intronic
973151321 4:46891954-46891976 CAGAATAGAGTGAAAAGGTAAGG - Intronic
975492563 4:75004692-75004714 CAGATTAAAGGGAAGGGGAAGGG + Intronic
975836177 4:78424299-78424321 CAAAACAAAGGGCAGAGGTTAGG - Intronic
975839068 4:78455095-78455117 CAGAGCAAAGAGAAGAGGACTGG - Intronic
976036685 4:80831574-80831596 TAGAAGAATGGGAATAGGTCTGG - Intronic
976188980 4:82471124-82471146 CAGAATAAAGAAAAGATGTAAGG - Intergenic
976248419 4:83026445-83026467 TAAAACAGAGGGAAGAGGTCGGG - Intergenic
977443221 4:97097121-97097143 CAAAATAAAGGGATGGGCTCTGG + Intergenic
978032400 4:103951148-103951170 CAGAATTAAAGGAAAAGGTTGGG + Intergenic
978074054 4:104507156-104507178 CAGAATCAAGGAAAGAGTTGTGG - Intergenic
979211680 4:118112310-118112332 ATGAATAAAGGGAAGATGACAGG + Intronic
979450728 4:120867615-120867637 CACAATAAAGGGAAGCAGTTGGG + Intronic
979469206 4:121074130-121074152 CAGAAGCAAGTGAAGAGGTTAGG + Intergenic
979833145 4:125326354-125326376 CAGAATACAGGCAAGAGAGCTGG + Intronic
979885803 4:126025855-126025877 CAGGATAAAGAGAAAAGGTGGGG - Intergenic
980448740 4:132944278-132944300 CTGAATAATGGGCAGAGGTTGGG - Intergenic
982270369 4:153579769-153579791 CAGAAAAAAAAGAATAGGTCAGG - Intronic
983028767 4:162771921-162771943 CAGAACAAAGAGAAGAGGAGAGG + Intergenic
984763011 4:183378495-183378517 CAAAATAAAGGGATGGGCTCTGG + Intergenic
987681000 5:21135776-21135798 CACAATACAGGGGAAAGGTCGGG + Intergenic
988832831 5:35004220-35004242 CAGAACAAAGTGAAGAGTTAAGG - Intronic
988996222 5:36717222-36717244 CAGTAGAAAGGGAAAAGGTTAGG + Intergenic
989467882 5:41778432-41778454 CAGTTTAGAGAGAAGAGGTCTGG + Intronic
990886430 5:60599752-60599774 TGAAATAAAGGGAAGAGCTCTGG - Intronic
992102833 5:73423705-73423727 CAGAACAAAGAGAACAGGACAGG + Intergenic
993152998 5:84184306-84184328 CGAAATAAAGGGAAGAGCTGGGG + Intronic
993285823 5:85994640-85994662 AAGAATGAAGGGAAGAAGTAAGG + Intergenic
993499756 5:88651989-88652011 CTGAGCAAAGGGAAGGGGTCAGG - Intergenic
993784636 5:92114652-92114674 GAGAAGGAAGGGAAGAGGTAGGG + Intergenic
994023755 5:95058649-95058671 AAAAATAAATGGAAGAGGTATGG + Intronic
996383121 5:122882534-122882556 CAGAACAAAGAGATGAGGGCAGG - Intronic
996593852 5:125179154-125179176 CAGAATAAGCCAAAGAGGTCTGG + Intergenic
997527528 5:134562919-134562941 CAGGAGATAGGGATGAGGTCTGG + Intronic
997708853 5:135986124-135986146 GAGAAGAAAGGGAAGAGGGAAGG - Intergenic
997952429 5:138252986-138253008 CAGAATCAAGGGAAGCGTGCAGG + Exonic
998506227 5:142674864-142674886 CAGAATAAGAGGGAGAGGCCTGG + Intronic
998771785 5:145553999-145554021 CAGAAAAGAAGGAAGAGGGCTGG + Intronic
999065095 5:148676935-148676957 TGGAATTAAGGAAAGAGGTCAGG - Intronic
999237581 5:150108353-150108375 CAAAAAAAGGGGCAGAGGTCAGG + Intronic
999284020 5:150383296-150383318 CACAATAGAGGAAAGAGCTCTGG - Intronic
999928598 5:156406434-156406456 CAAAATAAAGAGAAGAGGAGAGG - Intronic
1000222190 5:159224716-159224738 CTGAATGAAGGGAAGATGTGAGG - Intergenic
1000543538 5:162570331-162570353 CAGGATAAAAGGAAGAAGCCAGG + Intergenic
1002392537 5:178927087-178927109 CAAAATAAGGGGTAGAGGACTGG - Intronic
1004804059 6:19182660-19182682 CAGAGTAAAGGAGAGAGATCTGG + Intergenic
1005001583 6:21247160-21247182 CAGAAGGAACGAAAGAGGTCAGG - Intergenic
1005150326 6:22741458-22741480 CAGATTCAAGGAATGAGGTCAGG - Intergenic
1005287052 6:24339056-24339078 CTGAATCACGGGAAGAGGTTGGG - Intronic
1006438232 6:34037879-34037901 AAGAATAAAGGAAAGGGGTAAGG + Intronic
1006442562 6:34061343-34061365 CAGAGTACAGAGAAGAGCTCTGG - Intronic
1007504056 6:42320839-42320861 AACAATAAAGGGAACAGGTGAGG + Intronic
1008721344 6:54357503-54357525 AAGAATAAAGGGAGAAGATCAGG - Intronic
1009284349 6:61797019-61797041 CAGAATAAAACGAAGTAGTCTGG + Intronic
1010395959 6:75392310-75392332 TAGAGTTCAGGGAAGAGGTCTGG - Intronic
1010759966 6:79711396-79711418 GTTAATAAAGGGAAGATGTCTGG - Intergenic
1010883236 6:81205368-81205390 CAGTATTAAGGGAGGAGGCCTGG + Intergenic
1012184870 6:96200282-96200304 CAGAATAAAAGGTAGAGACCAGG + Intronic
1012411421 6:98962408-98962430 CAGTATACAGAGAAGATGTCTGG + Intergenic
1013347873 6:109279512-109279534 CAGAATAGAGGGCTGGGGTCAGG - Intergenic
1014863888 6:126505117-126505139 CAAAATAAAGGGATGGGCTCTGG - Intergenic
1015489061 6:133804922-133804944 CAGCATTAAGCGAAGAGGTGTGG + Intergenic
1015862409 6:137694955-137694977 CAGGAGAAAGGGAGGAGGCCAGG - Intergenic
1016610895 6:145988417-145988439 AATAATAAAGGCAAGAAGTCTGG + Intergenic
1016772805 6:147870784-147870806 AAGAAAAAAGGGAAGAGGGAAGG + Intergenic
1016806402 6:148216712-148216734 AAGAAAAAAGAGATGAGGTCAGG - Intergenic
1017278413 6:152596673-152596695 CAGAATGAAAGGAAAAGGTATGG + Intronic
1017820700 6:158047141-158047163 CAAAAATAAGTGAAGAGGTCTGG + Intronic
1018491042 6:164293639-164293661 CAAAGTAAAGGAGAGAGGTCTGG + Intergenic
1019083996 6:169457053-169457075 CAGAACCTAGGGAAGAGGCCAGG + Intergenic
1019101711 6:169635873-169635895 GAGGAAAAAGGGAAGAGGACAGG + Intronic
1020977819 7:15028765-15028787 ATGAATAAATGGAAGAGGTGTGG + Intergenic
1023116566 7:36868642-36868664 CAGAATAAGGAGAAGCGGGCAGG - Intronic
1024389687 7:48794075-48794097 CAGAATACAGGAGAGAGATCAGG + Intergenic
1025270792 7:57512377-57512399 CAGAGTTCAGGGAAAAGGTCTGG - Intergenic
1027518487 7:79172109-79172131 AAGAAGGAAGGGAAGAGGGCAGG + Intronic
1028927833 7:96379284-96379306 CAGAATGAAGGAAAGAATTCTGG - Intergenic
1029639452 7:101810380-101810402 AAAAATAAAGAAAAGAGGTCAGG + Intergenic
1030511270 7:110485131-110485153 GAGGATAATGGGAAGAGCTCTGG - Intergenic
1031080822 7:117255366-117255388 TAGAACAGAGGGAAGAGGTTGGG + Intergenic
1032543172 7:132721173-132721195 CAGAAGAAAGGAAGGAGGTAAGG + Intronic
1032725704 7:134588456-134588478 CAAAATAAAGGGATGGGCTCTGG + Intergenic
1033569875 7:142617185-142617207 TAGAATTTAGGGAAAAGGTCTGG + Intergenic
1034278826 7:149837792-149837814 CAGAATTAAAGCAAGAGGTAGGG - Intergenic
1036371966 8:8169753-8169775 CAGAATAGAGGGAAAGGGTTGGG - Intergenic
1036428922 8:8671514-8671536 GAGGAGAAAGGGAAGAGGACTGG + Intergenic
1036878938 8:12495890-12495912 CAGAATAGAGGGAAAGGGTTGGG + Intergenic
1037288412 8:17325194-17325216 CAGTCTAAAGGGAAGAGCCCCGG - Intronic
1037738518 8:21586045-21586067 CTGAATTCAGGGGAGAGGTCAGG + Intergenic
1040062475 8:43115676-43115698 CAGAATAGACTGAAGAGGTAGGG - Intronic
1040101774 8:43512460-43512482 CAGGAGGAAGGGAAGAGGGCAGG - Intergenic
1040596413 8:48841700-48841722 CAGAATACAGGGGAGAGGCATGG + Intergenic
1040609405 8:48967745-48967767 CAGAATTAAAGGAATAGGTTGGG - Intergenic
1040955945 8:52980079-52980101 CAAAATAAAGGGATGGGCTCTGG + Intergenic
1042150336 8:65775921-65775943 CAAAGAAAAGGGAAGAGGCCGGG - Intronic
1042888920 8:73585585-73585607 AAGAGTAAGGGGAAGAGGTCAGG + Intronic
1042938009 8:74079981-74080003 CAGAATAAAAGGAAAAAGTAAGG + Intergenic
1043456143 8:80414320-80414342 CAGTAGAAAGGAAAGAGGTGGGG + Intergenic
1044661995 8:94600636-94600658 CAGAAGAAAGCGATGAGGCCGGG + Intergenic
1045334819 8:101190727-101190749 CACAATGCAGGGAGGAGGTCAGG - Intronic
1046001058 8:108421346-108421368 CATAATAAAGGGATGGGCTCTGG + Intronic
1046246824 8:111574548-111574570 CAGAAAGACGGGAAGAGTTCAGG + Intergenic
1046893635 8:119449795-119449817 CAGATGAAAAGGAAGAGGGCCGG - Intergenic
1048397001 8:134023295-134023317 CAGAATAAATGGAAGATGAGTGG + Intergenic
1049510008 8:143022576-143022598 CAGAAGAAAGGGCAGAGCACTGG - Intronic
1050602040 9:7262596-7262618 CAGAAAAAAGGGAAGTAGGCAGG + Intergenic
1050643700 9:7695625-7695647 CTGGAAAAAGGGAAGAGGACAGG + Intergenic
1050753636 9:8972494-8972516 AAGAAGAAAGGGAAGAGGAGAGG + Intronic
1051330962 9:16024648-16024670 CAGAATAAAGGGAATTGCTTGGG - Intronic
1051531071 9:18104329-18104351 CCAAATAAAGGGACGAAGTCAGG + Intergenic
1051534540 9:18142135-18142157 AAAAAGAAGGGGAAGAGGTCAGG - Intergenic
1051575534 9:18611271-18611293 CAGAAGCAAGGCCAGAGGTCAGG + Intronic
1051576803 9:18625153-18625175 CAGAAGACAGGGGAGAGATCTGG - Intronic
1051716931 9:19994776-19994798 CAGACTAAAGGAAGGAGCTCAGG - Intergenic
1051922814 9:22287658-22287680 TAGAAGAAAGGGAAGAAGTGGGG - Intergenic
1052839235 9:33277376-33277398 CAGACTATAGGGAAGAAGTATGG + Intronic
1053539585 9:38959511-38959533 CCGAATTAAAGGAAGAGGTTGGG + Intergenic
1054626556 9:67404407-67404429 CCGAATTAAAGGAAGAGGTTGGG - Intergenic
1054912260 9:70465461-70465483 GGGAAGAAAGGGAAGAGGTTAGG + Intergenic
1055645846 9:78360536-78360558 CAGATTCAAGGTAAGAGCTCAGG + Intergenic
1055997819 9:82180877-82180899 CAGAACAAAGGGAAGACTTGAGG - Intergenic
1057386293 9:94608491-94608513 CAGAAGAATGGGAAGCAGTCAGG + Intronic
1057727585 9:97579045-97579067 GAGAATGCTGGGAAGAGGTCAGG - Intronic
1058006391 9:99920041-99920063 CAGAAAAAAGGAACGAGGTTGGG - Intronic
1058520464 9:105810471-105810493 CAAAATAAAGGGATGGGCTCTGG + Intergenic
1059365089 9:113780762-113780784 CTGGATTCAGGGAAGAGGTCTGG - Intergenic
1060533082 9:124360230-124360252 CAAACTAAAGGCAAGAGGTGGGG + Intronic
1060763434 9:126275303-126275325 CAGAATAAAGAGAAGAGGAGAGG - Intergenic
1062002565 9:134224119-134224141 CAGAAGAAAGGTAAGAGATTCGG - Intergenic
1062585028 9:137245349-137245371 CAGTATACGGGGAAGAGGCCTGG - Exonic
1203427414 Un_GL000195v1:54279-54301 CAGAATAAAAAGAAGAGGGTTGG - Intergenic
1203438793 Un_GL000195v1:168676-168698 CAGAATAAAAAGAAGAGGGTTGG + Intergenic
1185818365 X:3178397-3178419 TAAAATCAAGGGGAGAGGTCAGG + Intergenic
1186325913 X:8476556-8476578 CAGAATGAAGGGAAGAAATTTGG - Intergenic
1186665701 X:11714834-11714856 AAGAACAAAGGGAAGAGTTTGGG + Intergenic
1186766009 X:12771416-12771438 CATAATATAGGGAAGAGGGCAGG - Intergenic
1186813556 X:13213588-13213610 ATGAATAAAGGGAAGAGGGTTGG + Intergenic
1187052048 X:15704566-15704588 CAGATTAAAGGAAAGAAGCCAGG + Intronic
1187239054 X:17496062-17496084 CAGGAGGAAGGGAAGAGGTAGGG - Intronic
1187465048 X:19519635-19519657 CTAAATATATGGAAGAGGTCAGG - Intergenic
1187681218 X:21769687-21769709 CAGATTCAAGGGAAGAGGAATGG + Intergenic
1187990899 X:24871045-24871067 CAGCATAATGGGCAGATGTCAGG + Intronic
1188838457 X:34986914-34986936 CAGAATGAAGGGAAGCTATCCGG - Intergenic
1189896561 X:45662994-45663016 CAGAATAAAGGGAAGCTGGCTGG - Intergenic
1191015329 X:55803707-55803729 CAGATTAAAGTGAACAGATCTGG + Intergenic
1191737727 X:64405009-64405031 TAAACTAAAGGGAAGAAGTCTGG + Intergenic
1192578379 X:72260674-72260696 CATGAAAAAAGGAAGAGGTCCGG - Intronic
1193339734 X:80334126-80334148 CATAATAAAGGGAAGAGCACTGG - Intergenic
1193396367 X:80988494-80988516 CAAAATAAAGGGATGGGATCTGG + Intergenic
1194971535 X:100349309-100349331 CAGAATAAAAGCAAGAGGTGAGG - Intronic
1195097267 X:101515100-101515122 CAGAAGAAAGGGATGAGCTCAGG - Intronic
1195175298 X:102309201-102309223 CTGAATAAAGGGAGGAGGACAGG + Intronic
1195183567 X:102377892-102377914 CTGAATAAAGGGAGGAGGACAGG - Intronic
1196070478 X:111515791-111515813 AAGAAAAAAGGGAAAGGGTCTGG + Intergenic
1198720675 X:139615919-139615941 CAGCACAAAGGAAAGATGTCTGG + Intronic
1200706365 Y:6446138-6446160 CAGAATAAAGGGAGGAAGTGAGG - Intergenic
1200708465 Y:6463069-6463091 TAGAATAAAGGGAGGAAGTGAGG - Intergenic
1200970878 Y:9151052-9151074 CAGAATTAAAGGAATAGGTTGGG + Intergenic
1201025647 Y:9701639-9701661 TAGAATAAAGGGAGGAAGTGAGG + Intergenic
1201027747 Y:9718570-9718592 CAGAATAAAGGGAGGAAGTGAGG + Intergenic
1201247756 Y:12022961-12022983 CAGAGGAAAGGGAAGAGGAGAGG + Intergenic
1201435992 Y:13959085-13959107 CAGAATGAAGGGAAGAAATCTGG + Intergenic
1201684123 Y:16682335-16682357 CAAAATAAAGGGATGAGCTCTGG + Intergenic
1202140155 Y:21713262-21713284 CAGAATTAAAGGAATAGGTTGGG - Intergenic