ID: 971470856

View in Genome Browser
Species Human (GRCh38)
Location 4:27024973-27024995
Sequence CTGCTGCTCCTGGGTGAGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 390
Summary {0: 1, 1: 1, 2: 4, 3: 38, 4: 346}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971470856 Original CRISPR CTGCTGCTCCTGGGTGAGAA GGG Intronic
900114128 1:1021270-1021292 CCGCTGCTCCTGGGTGTGGCTGG + Intronic
900385486 1:2408704-2408726 CTCCTGCTCCAGGGGGAGCAGGG + Exonic
900582487 1:3415924-3415946 CTGCTGCTCCGGGCTGCGGAGGG + Intronic
900757096 1:4443548-4443570 CTGCTGCTCCAGGGTGAAGTGGG - Intergenic
900974577 1:6009048-6009070 CTGCAGCTCCTGGGGGAGAAGGG - Intronic
901215160 1:7550874-7550896 CTGCTGGGCCTGGGAGAGAGAGG - Intronic
901934848 1:12619917-12619939 CAGCCGCTGCTGGGTGGGAAAGG - Intergenic
902608580 1:17583312-17583334 TCCCTGCTGCTGGGTGAGAAGGG - Intronic
902624042 1:17666639-17666661 CAGCTGTTCTTGGGGGAGAAAGG - Intronic
902882281 1:19380378-19380400 CTGCTGCTCATGGGGCAGCAGGG - Intronic
904229167 1:29053090-29053112 CAGCTGCTGCTATGTGAGAAAGG - Exonic
904797452 1:33067853-33067875 CTTCTTCTCCTGGTTGAGCAAGG - Intronic
905039042 1:34938035-34938057 CTGCTGCTCCTTGAAGAGCAGGG - Intergenic
905211063 1:36374452-36374474 CGGCTGCTCCTGGGAGCAAAGGG + Intronic
905259834 1:36709485-36709507 TTGTTGCCCCTGGGTGAGCACGG + Intergenic
906223810 1:44104495-44104517 CTCCTTCTCCTGGGTGCGCATGG + Intergenic
906632374 1:47382630-47382652 CTGCTGCTACTGTGTGCAAATGG + Intergenic
908419621 1:63947169-63947191 CTGCTGCTCCTGGGCCAACATGG - Intronic
909034838 1:70584868-70584890 GTGCCGCCCCTGAGTGAGAAAGG + Intergenic
909232186 1:73105111-73105133 CTTCTTCTCCTGGGTGCGCATGG - Intergenic
909232193 1:73105165-73105187 CTGCTGCTCCTTGTTGATGAAGG - Intergenic
909476327 1:76085055-76085077 ATGCAGCTCCTGAGTAAGAATGG + Intronic
911754979 1:101543705-101543727 CTGCTGCTGCTGGGTAAAAACGG + Intergenic
912208987 1:107537978-107538000 CTGCTTCTCCTGGGGCTGAAGGG + Intergenic
912442157 1:109707473-109707495 CTTCTTCTCCTGGTTGAGCAGGG - Intronic
912693752 1:111824499-111824521 CTGCTCCTACTTGGTTAGAAAGG + Intronic
912697086 1:111849637-111849659 GTGCAGGTCCTGGCTGAGAAGGG + Intronic
912704510 1:111902075-111902097 CTGCTGCACCTGAGTGAGGCCGG - Intronic
912950657 1:114118202-114118224 ATCGTGCTCCTGGGTGAGCAGGG - Intronic
915487826 1:156234333-156234355 CTGTTGGTCCTGTGGGAGAAAGG + Intronic
916009189 1:160689247-160689269 CTTCTTCTCCTGGTTGAGCAGGG + Intronic
916118132 1:161505540-161505562 TTGCTGCTGCTGGGTGAGTGAGG + Exonic
916448040 1:164891931-164891953 CAGCTCCTCCTGGGGGAAAAAGG + Intronic
917470609 1:175323100-175323122 CTTCTCCTCCTTGGTGGGAAAGG + Exonic
918013649 1:180611213-180611235 CTGCTGTTGCTGGGGAAGAAAGG - Intergenic
918926841 1:190797443-190797465 CTGGTTCTCCTGGGTGCCAAGGG - Intergenic
919300463 1:195756827-195756849 CTACTGCTCCCAGCTGAGAATGG + Intergenic
920616290 1:207496016-207496038 CTGCTGCACCTGGGTCAGCAAGG + Intergenic
920632795 1:207669195-207669217 CTGCTGCACCTGGGTCAGCAAGG + Intronic
920943011 1:210501636-210501658 CAGCTGCTCCTGGGGAAAAATGG + Intronic
921029725 1:211326821-211326843 CTGCTGCTCCTGGCTGCGGCCGG - Exonic
923024552 1:230194458-230194480 CTTCTGCCTCTGGGAGAGAAGGG - Intronic
923119677 1:230978651-230978673 CTGCAGCTCCTGCTTGAGCAGGG + Exonic
924794272 1:247281290-247281312 CTGCTGCTCCAGGCTGAGGGTGG + Intergenic
1063552337 10:7044881-7044903 CTGCTCCTTCTGGGTGACAGAGG + Intergenic
1063566346 10:7174727-7174749 CAGCAGCTCCTGAGTAAGAAAGG - Intronic
1064336223 10:14445189-14445211 CCTCTGCACCTGGGTGTGAAGGG + Intronic
1064954165 10:20888617-20888639 CTCCTGCTCCAGGGGGAGAGGGG + Intronic
1065350015 10:24786985-24787007 CTGCTGCTCCTGGGACAGAAAGG + Intergenic
1065846669 10:29749533-29749555 CTTCTTCTTCTGGGTGAGAGCGG - Intergenic
1066422422 10:35275372-35275394 CTGTTGTTCCTGTGAGAGAAAGG + Intronic
1067156116 10:43782597-43782619 TTGGTGCTCCTGGCTGGGAAGGG - Intergenic
1067284245 10:44895839-44895861 CTTCTGCTGCTGGGTGGGCAGGG + Intergenic
1067830115 10:49606931-49606953 CTGCTATTTCTGGTTGAGAAAGG + Intergenic
1069660412 10:70119944-70119966 CTTCTGCCCATGGGTGGGAACGG - Intronic
1069819502 10:71218590-71218612 CTGGTGCTCCAGGGGGAGGAAGG + Intronic
1069822581 10:71236740-71236762 CTGCTTCTCCTCTGGGAGAATGG + Intronic
1072627794 10:97124701-97124723 CTAGTGCTCCTGGGTGGGGAAGG - Intronic
1072737582 10:97889394-97889416 CTGCTGCTCCTCGGTGCAGACGG - Intronic
1072911794 10:99508662-99508684 CAGGGGCTCCTGGATGAGAAGGG + Intergenic
1074410123 10:113221103-113221125 CAGATACTCCTGGGTGAGGAGGG + Intergenic
1074875661 10:117611258-117611280 CTGCTGCTCCTGTCTGTGATGGG + Intergenic
1075658478 10:124176967-124176989 GAGCTGCTCCTGGGTTAGCACGG - Intergenic
1075729543 10:124628077-124628099 CTGCTGTTCCTGGGCCAGCAGGG + Intronic
1076583657 10:131531537-131531559 CTGCTCCCCCTGGGTGTGGAGGG - Intergenic
1076710887 10:132333502-132333524 CTGCTGTCCCTGGAAGAGAACGG + Exonic
1077019942 11:412903-412925 CTGCTGCTACGGGCTGGGAAAGG - Intronic
1077104459 11:836141-836163 TTGCTGCTTCTGGGTGAGGAGGG + Exonic
1077730431 11:4723894-4723916 CTCCTTCTCCTGGGTGCGCATGG + Intronic
1078624222 11:12939355-12939377 CTCCTGGTCCTGGGAGAGGATGG - Intronic
1078839552 11:15065662-15065684 CTTCTTCTCCTGGTTGAGCAGGG + Intronic
1080851293 11:36072502-36072524 GTTCTGCTCCTGTGGGAGAAGGG + Intronic
1082869808 11:57933764-57933786 CTGCAGCTCTTGGATAAGAAGGG + Intergenic
1083160911 11:60853571-60853593 CTGCTGGGCCTGGTGGAGAATGG - Exonic
1083245192 11:61421380-61421402 CAGCTTCTCCTGGGTGAGTGTGG - Exonic
1083427991 11:62599164-62599186 CTGCAGCTCCTTGGGGAGGAAGG - Intronic
1083654027 11:64220422-64220444 CTGCTGCTCCTGGGCGAGAGGGG - Exonic
1083784016 11:64933684-64933706 CTGCTGCTCCCTGGGGAGAGAGG - Exonic
1084459615 11:69289204-69289226 CTGCTGCTCCTGGGGCAGAGAGG - Intergenic
1085069204 11:73527177-73527199 CTGCTGTTAGTGGATGAGAAAGG - Intronic
1085477043 11:76795349-76795371 CTGCTGCTCTTGTTTAAGAAAGG + Intronic
1088842030 11:113635401-113635423 CAGCTGCTCTGGGGTGAGAGGGG - Intergenic
1089176210 11:116550762-116550784 CTTCTGCTCCTTGGAGAGCAGGG + Intergenic
1090243541 11:125200355-125200377 CTGCTGCTATTCGGTGAGATTGG - Intronic
1091136694 11:133197514-133197536 CTGCTTCTCATGGGTGACTAAGG + Intronic
1092243651 12:6850948-6850970 CTGCAACTCCTGGTTGAGATGGG - Exonic
1092322136 12:7487500-7487522 GTGCTCCTCCTGGGGTAGAAAGG + Exonic
1094277975 12:28700289-28700311 CTCCTGCTACTGGGCAAGAAGGG + Intergenic
1094865725 12:34528241-34528263 CTTCTTCTCCTGGTTGAGCAGGG - Intergenic
1096334254 12:50741241-50741263 CTGCTGCTCCTCTGTGAGATGGG - Intronic
1096370371 12:51064223-51064245 CAGCTGAGCCTGGATGAGAATGG + Exonic
1096627536 12:52904703-52904725 CTCCTTCTCCTGGGTGCGCACGG + Exonic
1096982654 12:55737338-55737360 CTGCTGCTCCAGGAAAAGAACGG - Intergenic
1097081395 12:56433802-56433824 CTGGTGGTGCTGGGTGAGGATGG + Exonic
1097130281 12:56806377-56806399 CTGGGGCTCCTGGGTGGCAATGG + Intergenic
1099555358 12:84102962-84102984 CTTCTTCTCCTGGTTGAGCAGGG + Intergenic
1100367832 12:93937665-93937687 CTGCAGCCCCTGGTTGAGAAAGG - Intergenic
1102039771 12:109793484-109793506 CGGCAGCTTCTGGGTGAGGAAGG - Intronic
1104301823 12:127571312-127571334 CTGCTGCTCCTGTCTGTCAAGGG + Intergenic
1106074300 13:26444374-26444396 CTGCTGCTCCTGGGATAAGAAGG - Intergenic
1109241139 13:59890086-59890108 CAGCTGCTACAGGGTGAGAGTGG - Intronic
1111253694 13:85639160-85639182 CAGCTGCTCCTGGGAGGGCAGGG + Intergenic
1112319817 13:98395863-98395885 CTGCTGCTGCTGGGAGACAATGG - Intronic
1113088785 13:106595789-106595811 CGCCTGCTCCTGGGTGTCAAAGG - Intergenic
1117334208 14:54743020-54743042 CTGCTTCTCCAGAATGAGAATGG + Intronic
1118751894 14:68813758-68813780 CTGCTGATTCTGGAGGAGAATGG + Intergenic
1119918033 14:78420567-78420589 GTGCAGCTTCAGGGTGAGAATGG + Intronic
1120669508 14:87347912-87347934 TTGTTGCTTCTGGGTGAAAAGGG + Intergenic
1121170299 14:91848204-91848226 CTGCTGCTTATGGGATAGAATGG + Intronic
1121325741 14:93018668-93018690 CTGGGGCTCTTGGGTGAGGAAGG + Intronic
1121456906 14:94044139-94044161 CTGCTCCTCCTGGCTGGGGAAGG + Intronic
1122099378 14:99394995-99395017 CTGCTGGTCCTGGGTGTGCTTGG - Intergenic
1123902974 15:24894567-24894589 TAGCTGCTCCTGGGAGGGAAAGG + Intronic
1124201180 15:27679716-27679738 ATGTTTGTCCTGGGTGAGAAGGG + Intergenic
1124269642 15:28268767-28268789 CTGTTGCTGCTGGGTGGGAAGGG - Intronic
1124441490 15:29689160-29689182 CTCCTGCTCCTGAGTGAGCCCGG + Intergenic
1124583163 15:30980290-30980312 CTGTAGCTCATTGGTGAGAAAGG - Intronic
1124689057 15:31806598-31806620 CTGCTGGTCCTGGGGGTCAAAGG + Intronic
1125567693 15:40689666-40689688 CTTCTTCTCCTGGTTGAGCAGGG + Intergenic
1125841125 15:42802134-42802156 CTTCTCCTCCTGGGTGCGCACGG + Intronic
1125955862 15:43790846-43790868 CTGCTGCTCCTGGGTTCACACGG + Intronic
1127641265 15:60917981-60918003 TTGCTGTTACTGGCTGAGAATGG - Intronic
1128067330 15:64773606-64773628 CCACTGCTGTTGGGTGAGAAGGG - Intronic
1128285678 15:66435101-66435123 CTTCTGCTTCTGGGTAAGAAAGG - Exonic
1128377610 15:67088617-67088639 CAGCTGCTCTAGGGTGGGAAGGG + Intronic
1128554740 15:68623685-68623707 CTGCTGCTCCTGGGAGCAACAGG - Intronic
1129270160 15:74415302-74415324 CTGTGGCTCCTGGGTGAGTGGGG - Intronic
1129598031 15:76980173-76980195 CTCCTTCTCCTGGGTGTGCATGG + Intergenic
1129688638 15:77700708-77700730 CTGCTAAACCTGGGTGAGCAGGG + Intronic
1131249400 15:90820548-90820570 CTGCTCTTCCTAGGTGAGGAGGG - Intergenic
1131254111 15:90850425-90850447 CCACTGCGCCTGGCTGAGAAAGG + Intergenic
1131265884 15:90915086-90915108 GGGCTGCTCCTGGCAGAGAAAGG - Intronic
1131398734 15:92107781-92107803 CTCCTGCTTCTAGGAGAGAAGGG + Intronic
1131846868 15:96497447-96497469 CTGCTGCTTCTAGATGAGAGGGG + Intergenic
1132381660 15:101370515-101370537 GGGATGCTCCTGGGGGAGAAGGG + Exonic
1132652518 16:1028038-1028060 CTGCTGCTCCTGTGGGAGGTGGG - Intergenic
1132701803 16:1225206-1225228 CTGCTGCTCCTGGCTGTGCCCGG - Exonic
1133381945 16:5338400-5338422 CTGCTTCTCCTTGGCAAGAAAGG - Intergenic
1133560363 16:6944973-6944995 TTGCTCCTCCTGGGTGAAAAGGG + Intronic
1133865562 16:9638705-9638727 CTGCTTCTTCTGGGTCAGCAGGG - Intergenic
1134320788 16:13160844-13160866 CTGCTGCGTCTGGCTGAGACAGG + Intronic
1135329726 16:21551103-21551125 CCACCGCTCCTGGGTGAGCAAGG + Intergenic
1136340065 16:29637073-29637095 CCACCGCTCCTGGGTGAGCAAGG + Intergenic
1136631399 16:31491030-31491052 CTGCCTCTGCTGGGTGAGTATGG + Intronic
1136716560 16:32287503-32287525 CTGCTGCTTCTGGGTGAACCTGG + Intergenic
1136834948 16:33493781-33493803 CTGCTGCTTCTGGGTGAACCTGG + Intergenic
1136989267 16:35142268-35142290 CCTCTGCTCCTGGGTGGGACTGG + Intergenic
1138175942 16:54898284-54898306 ATGCAGCTGCTGGGAGAGAAGGG + Intergenic
1138492256 16:57383389-57383411 CTGATGCTCATGTGTGAGATGGG - Exonic
1140753826 16:78049619-78049641 CTCCTTCTCCTGGGTGTGCACGG + Intronic
1140933670 16:79651481-79651503 CTGCTGCTCTTTGGGGAGAAGGG + Intergenic
1141895151 16:86954388-86954410 CTGCAGCTCCTGTGTGAGATCGG + Intergenic
1142042744 16:87905644-87905666 CCACCGCTCCTGGGTGAGCAAGG + Intronic
1142174253 16:88637869-88637891 CTGCTGCTGGTGGGTGCCAAGGG - Intergenic
1203009855 16_KI270728v1_random:230251-230273 CTGCTGCTTCTGGGTGAACCTGG - Intergenic
1203145110 16_KI270728v1_random:1794069-1794091 CTGCTGCTTCTGGGTGAACCTGG + Intergenic
1142873770 17:2838434-2838456 CTTCTGCTCCAGGGTGAGCAGGG + Intronic
1143042225 17:4047101-4047123 CGGCTGCTGGTGGGTGGGAAGGG + Intronic
1143110826 17:4551940-4551962 CAGCTGCTCCTTGGTCAGCAGGG + Exonic
1143178310 17:4968954-4968976 GTCCTGCTTCTTGGTGAGAAAGG + Exonic
1143711090 17:8735780-8735802 CTGCTTCTCCTGGGTTTGTACGG + Intronic
1143782815 17:9238302-9238324 CTGCTGCTCCTGTCTCAGGAGGG + Intronic
1146512199 17:33459745-33459767 CTGCTGCTCCTGGGCTGGCAGGG - Intronic
1147909529 17:43847247-43847269 CTGCTGCTCCCAGGTGAGATGGG + Exonic
1147921401 17:43919340-43919362 CTGCTGCTACGGGGGAAGAAAGG - Intergenic
1151426460 17:74033901-74033923 CTGCAGATTCAGGGTGAGAAGGG + Intergenic
1151448198 17:74180990-74181012 CTCCTGCTCTTGGGTGACGATGG - Intergenic
1151547480 17:74802002-74802024 CTGCTGCTCCTGTCTGAGCACGG + Intronic
1152228330 17:79102780-79102802 CCGCTGCTCCATGGTGAGCAGGG + Intronic
1152233021 17:79124514-79124536 TTGCTGCTGCTGGCTGGGAATGG - Intronic
1152475349 17:80514207-80514229 CTGCGGTTCCTGGGAGAGGAGGG - Intergenic
1153548884 18:6239868-6239890 CTGCTGGTGCTGCGTTAGAATGG - Exonic
1154024007 18:10689854-10689876 CTTGAGCTCCTGGGTGAGCAGGG - Intronic
1155294487 18:24372538-24372560 CTGCTGCTGTTGAGTGAGGAGGG - Intronic
1157453284 18:47803901-47803923 ATGCTGCTGGTGGGTGAGAAAGG - Intergenic
1157756572 18:50223076-50223098 CTTCTTCTCCTGGTTGAGCAGGG + Intergenic
1157859299 18:51126133-51126155 CTTCTGGGCCTGGGTGAGCAGGG + Intergenic
1159903292 18:74067788-74067810 CTGCAGGCCCTGGATGAGAATGG - Intergenic
1160698716 19:496539-496561 GGGCTCCTCCTCGGTGAGAAGGG + Exonic
1161215850 19:3094775-3094797 CTGCTGCTGCTCGGTGAGTGCGG + Exonic
1161963222 19:7534227-7534249 CTGCGGCCCCTGGGTGAGTCTGG + Exonic
1163723414 19:18909160-18909182 CTGCTGCTCCTGGGGGACCCAGG + Intronic
1164145673 19:22511096-22511118 CTGCTGCTCTAGGCTGGGAAAGG + Intronic
1164155721 19:22595957-22595979 CTCCTGCTCCAGGGGCAGAACGG - Intergenic
1164330222 19:24247329-24247351 CTTCTTCTCCTGGTTGAGCAAGG - Intergenic
1164377975 19:27706146-27706168 CTTCTTCTCCTGGTTGAGCAGGG + Intergenic
1165450482 19:35879350-35879372 CTGCTCCTCCAGGGTCAGCATGG - Exonic
1165766082 19:38352110-38352132 GTGCTGCTGCGGGGTGAGCAGGG + Intronic
1166155613 19:40909272-40909294 CAGCACTTCCTGGGTGAGAAGGG - Intergenic
1166266682 19:41688724-41688746 CTACAGCTCCTGGGTGTGGAGGG + Intronic
1167483489 19:49746790-49746812 CAGCTTCTCCTGGGTGGTAAGGG + Exonic
1167586329 19:50377674-50377696 CTTCTGCTCGTGTGTGATAAGGG - Intronic
925795928 2:7542849-7542871 AGGATGCTCCTGGGTCAGAAAGG - Intergenic
926053052 2:9756997-9757019 CTTCTGCTCCTGGCCGGGAATGG - Intergenic
928129372 2:28638531-28638553 CTGCTGTTGATGGGTGAGAGAGG + Intronic
928895455 2:36257290-36257312 CTTTGGCTCCTGAGTGAGAAAGG - Intergenic
929789111 2:45010721-45010743 GTGCTGGTCCTGTGGGAGAAGGG + Intergenic
929862334 2:45690332-45690354 CTGCTTCTCTTGGGGGATAAAGG + Intronic
932640504 2:73441032-73441054 CTGCTGGTGCTGTGTGGGAAGGG + Intronic
933041188 2:77468837-77468859 CTGCTGCTCAGATGTGAGAAAGG - Intronic
934640633 2:96025316-96025338 CTGCTCCTCCTGTAGGAGAAGGG + Intronic
935142360 2:100364572-100364594 CTTCTTCTCCTGGTTGAGCAGGG + Intergenic
936682602 2:114791430-114791452 CAGCAGCTCCTGAGTGAGACAGG - Intronic
936861548 2:117026340-117026362 CTCCTGCTGTTGGGGGAGAAAGG + Intergenic
937112381 2:119376663-119376685 CTTCTCCTCCTGGTTGAGCAGGG + Intergenic
937236527 2:120434650-120434672 CTCCCGCTCCTGGGAGAGACAGG - Intergenic
937828164 2:126390214-126390236 TTGCTGCTGCTGGGTGGGAATGG + Intergenic
937870451 2:126782443-126782465 CTGTTTCTCCTTGGGGAGAAAGG - Intergenic
938644450 2:133316712-133316734 CTACTGCCGCTGGGTGGGAATGG + Intronic
938667496 2:133553668-133553690 CTACTGCTCCAGGGTGACTAGGG - Intronic
940788043 2:158002994-158003016 CTGCTGGTCCAGGTTAAGAATGG + Intronic
942773989 2:179558803-179558825 CTGCCGCTCCTGGGTGAGAATGG - Intronic
943687571 2:190834908-190834930 CTGCTGCTCCTCGTGGAGCAGGG + Intergenic
944012089 2:194984405-194984427 CTGCTGCTTCTGGTAGAGAGGGG - Intergenic
944089593 2:195891108-195891130 CAGCTGCTACTGGCTGTGAATGG - Intronic
944661464 2:201924958-201924980 CTGCTGGTCCTGCTTGAGAGGGG + Intergenic
944866737 2:203870028-203870050 CAGCTACTCCTGGGTGACAGAGG + Intronic
945102420 2:206274612-206274634 CCGCCGCTCCTGCGTCAGAAGGG + Intergenic
946019851 2:216633587-216633609 CTGCTGCTACTGGGCGCGAGTGG + Exonic
946283026 2:218680068-218680090 CCTCTGCACCTCGGTGAGAAGGG + Exonic
948057046 2:235016294-235016316 CTGCTGCTTCTGTGTAAGAAGGG + Intronic
948173226 2:235923450-235923472 CTGCTGCTTCTGGATGTGAGTGG - Intronic
948364346 2:237444899-237444921 CTGGGGCACCTGGGAGAGAAGGG + Intergenic
948936295 2:241167031-241167053 GTCCTGCACCTGAGTGAGAAGGG - Intronic
949060404 2:241953426-241953448 CTGCTCCTGGAGGGTGAGAAGGG + Intergenic
1168871712 20:1134952-1134974 CTGCTGGACCTGGGTGAGGGGGG - Intronic
1168940093 20:1702481-1702503 CTGCTGCTCCTGGGAGTGAGTGG - Intergenic
1169122155 20:3103152-3103174 GTGCAGTTCCTGGGAGAGAAGGG - Intergenic
1169717468 20:8636599-8636621 CTGCTGCTTCTGTGTGTGTAAGG - Intronic
1169977176 20:11342812-11342834 AGGCTGCTCCTGGGGGAGGAGGG + Intergenic
1170926905 20:20733169-20733191 CCGCCGCACCTGGCTGAGAATGG - Intergenic
1171152791 20:22842445-22842467 CAGGGGCTCCTGGGTGGGAAGGG + Intergenic
1171423916 20:25037736-25037758 ACGCTCCTCCTGCGTGAGAAGGG - Intronic
1172260820 20:33563812-33563834 CTTCAGCTCCTGGGCAAGAATGG + Intronic
1172806645 20:37616622-37616644 TGGCTGCTGCTGGGTTAGAAAGG + Intergenic
1173883931 20:46440141-46440163 CTCCTGCTCCTGGGAGAAACTGG - Intergenic
1173909210 20:46651539-46651561 CTGCTCCTCCTGGAGGAAAAGGG + Intronic
1174293226 20:49524113-49524135 CTGCTGCACCTGGAGGAGATGGG - Exonic
1174539178 20:51275710-51275732 CTCCTTCTCCTCGGTGAGGATGG - Intergenic
1175172212 20:57088753-57088775 CTGGTGATCATGGGTGGGAAGGG + Intergenic
1175429567 20:58891853-58891875 CTGCTGCTGCTGGGTAAGGGCGG + Intronic
1175440817 20:58989910-58989932 CTGCTCCTCCTGGGCCAGCACGG - Exonic
1175691084 20:61066469-61066491 CTGCTGCCTCTGGGTGTGTAAGG - Intergenic
1175827936 20:61946754-61946776 GTGCTCCTCATCGGTGAGAAGGG - Intergenic
1175827953 20:61946851-61946873 GTGCTCCTCATCGGTGAGAAGGG - Intergenic
1175828119 20:61947894-61947916 GTGCTCCTCATCGGTGAGAAGGG - Intergenic
1176266625 20:64212642-64212664 CTCTTGCTCCTGAGTGGGAAGGG + Intronic
1176279054 20:64290429-64290451 CTGAAGCTCCTGGGTCAGCATGG - Intergenic
1179625683 21:42648237-42648259 CTGCTGGTCCATGGTGAGAAGGG + Intergenic
1179881485 21:44294979-44295001 CTCCTGCTCCGGGGTCAGAGAGG + Intronic
1180082556 21:45493489-45493511 CTGCCATTCCAGGGTGAGAAGGG + Exonic
1180594037 22:16962145-16962167 CAGCTGCTCCCGGGTGGGAGAGG - Exonic
1181441677 22:22939258-22939280 CTCCTGCTCCTGGGTGGGGAGGG - Intergenic
1182446060 22:30390306-30390328 CTGCTGCTTTGGGGTGAGGAGGG + Intronic
1182510108 22:30813589-30813611 CTGCAGCAGCTGGGTGAGGATGG - Intronic
1183947682 22:41335981-41336003 CTGCTGGTCCTGGGAAAGGAAGG + Intronic
1184681542 22:46074823-46074845 CAGACCCTCCTGGGTGAGAAGGG + Intronic
1184814078 22:46857306-46857328 CTGCTGCCCCTGGGTGGGGCTGG + Intronic
1185325977 22:50226040-50226062 CTGCTGCCCCCGGGTGAGGAGGG - Exonic
1185339264 22:50284307-50284329 CTGCTGCCCTTGGCTGGGAAGGG - Intronic
949930539 3:9074847-9074869 CAGCTGCTACTGGGTATGAATGG + Intronic
951208414 3:19947623-19947645 CTGCTGCGCGTGAGGGAGAAGGG - Intronic
953262186 3:41350735-41350757 CTCCTGCTCCTGTGTTAGGATGG - Intronic
953298161 3:41742405-41742427 CTGCTTCTGCTGGTTGGGAATGG - Intronic
953461223 3:43082631-43082653 GTGCTGCTCCTGTGTCACAAAGG - Intronic
954316831 3:49805989-49806011 GTGCTGCTCCTAGAGGAGAAAGG + Exonic
954459406 3:50617710-50617732 GTGCTGGGCCTGGGTGTGAACGG + Exonic
954692573 3:52403442-52403464 CTGCTGCACCTGGCTGAGGATGG - Exonic
955155085 3:56408821-56408843 CTGCTGCTCCTGGGGGACAGCGG - Intronic
955839584 3:63097523-63097545 CTGCTCCTCCTGGGTGCGCATGG + Intergenic
956045237 3:65189255-65189277 ATTCTTGTCCTGGGTGAGAAAGG - Intergenic
956942643 3:74181487-74181509 AAGCTCCTCCTGGGTGAAAATGG - Intergenic
957715131 3:83918292-83918314 CTGTGGCTCCTGGTTGAGAGAGG - Intergenic
959279150 3:104316243-104316265 CTGCTGCTGGTGGGTGAGAGAGG - Intergenic
961213133 3:125141042-125141064 CTGCAGCTGCTGCGTGTGAATGG + Intronic
961217199 3:125168847-125168869 CTGCTTCTGCTGGGTGAGGGAGG - Intronic
961445478 3:126979018-126979040 CCACTGCTACTGGGTGAGGAAGG - Intergenic
961922864 3:130446182-130446204 CTTCTTCTCCTGGTTGAGCAGGG + Intronic
962865966 3:139448223-139448245 CAGCTGCTGCTGGCTGAGAAGGG - Intergenic
965605668 3:170495697-170495719 CTCCTTCTCCTGGGTGTGCATGG - Intronic
966443217 3:179970453-179970475 CTCCTGCTCCTGGGTAAAACAGG - Intronic
968450419 4:673684-673706 CGGCTGCTTCTTGGTGAAAACGG - Intronic
969008917 4:4044811-4044833 CTTCTTCTCCTGGTTGAGCAGGG + Intergenic
969866965 4:10082594-10082616 CTTCTGCTCAAGGGTGAGATGGG - Intronic
970406961 4:15773107-15773129 AAGCTCTTCCTGGGTGAGAAAGG + Intergenic
971470856 4:27024973-27024995 CTGCTGCTCCTGGGTGAGAAGGG + Intronic
971554954 4:28002128-28002150 CTGCAGCTCCTGTGGGAGATGGG + Intergenic
971876946 4:32319351-32319373 CTGCTGCGCCAGGGTGGGCATGG + Intergenic
972195277 4:36646440-36646462 CTTCTGTTTCTGGGTGGGAATGG + Intergenic
972602618 4:40586453-40586475 AGGGTGCTCCTGGGTAAGAAGGG + Intronic
974364345 4:60926961-60926983 CAGCTGCTTCTGGGGCAGAAAGG - Intergenic
975869811 4:78767411-78767433 CTGCTAATCCAGGGTTAGAATGG - Intergenic
978219825 4:106256567-106256589 CAGCTGCACCTGGGAGAGCAGGG + Intronic
978249188 4:106610303-106610325 CTGCTGCACCTGGGCGGGCAGGG - Intergenic
979277201 4:118827673-118827695 ATGATTCTCCTGGGAGAGAATGG + Intronic
981929422 4:150173775-150173797 GTGCTGCTCCTGGATGAGGTTGG + Intronic
984177606 4:176438415-176438437 CTGCTCCTCCTGGAAAAGAAAGG + Intergenic
984852970 4:184169488-184169510 CTGCTGCTCCAGGCAGAGAGAGG - Intronic
986218039 5:5739418-5739440 CAGCTACTCCTGGGTGAGTTAGG + Intergenic
986964194 5:13250949-13250971 CTGATGCTCCTGTTTGTGAAGGG - Intergenic
989318654 5:40110062-40110084 CTTCTTCTCCTGGTTGAGAAGGG - Intergenic
990252923 5:53935280-53935302 CTACTGCTCCTGGATGAGGGTGG - Intronic
991295515 5:65076104-65076126 CTGCAGCTCCTGGGGAGGAAAGG + Intergenic
992472235 5:77069436-77069458 CTTCTGTTCCTGGGTGAGCCAGG + Intergenic
992737160 5:79733908-79733930 CTGATGATCTTGGGAGAGAAAGG - Exonic
993090375 5:83418638-83418660 CTGTGGCTCCTGTGAGAGAAAGG + Intergenic
994320902 5:98393248-98393270 CTCCTTCTCCTGGGTGCGCACGG + Intergenic
994679723 5:102870875-102870897 CAGTGGGTCCTGGGTGAGAAAGG - Intronic
994977774 5:106831972-106831994 CTGCTGCTCCTGGCTGGGCTTGG - Intergenic
996537438 5:124593153-124593175 CTGGGGCTCCTGGGGTAGAAGGG + Intergenic
996862433 5:128082725-128082747 CTGATGTTCCAAGGTGAGAAGGG - Intergenic
998212879 5:140214573-140214595 AGGCTGCTCCTGGGTGAAAGGGG - Intronic
999089925 5:148927097-148927119 CTACAGCTCTTGGGAGAGAATGG - Intronic
1001287661 5:170435556-170435578 CTTCTCCTCCTGGGAGAGAATGG - Intronic
1001449644 5:171814728-171814750 CAGCTCCTCCTGGGTGAGCTGGG - Intergenic
1001521839 5:172399963-172399985 CTTCTTCTCCTGGTTGAGCAGGG - Intronic
1002433752 5:179219203-179219225 CTGCTGCTCCTGGGGGAAGGAGG - Intronic
1003123627 6:3337991-3338013 CTCTTGCTCCTGTGGGAGAAGGG - Intronic
1003256670 6:4481137-4481159 CTGCTGCTTCTCTGTGAGATAGG - Intergenic
1003560023 6:7172568-7172590 CTTCTCTTCCTGGGTGAGAAGGG - Intronic
1004025270 6:11812037-11812059 TTGCTGCTCTTGGGTGAGTTGGG + Intergenic
1004783503 6:18939381-18939403 TTGCTGCTTCGGGCTGAGAAAGG + Intergenic
1005246126 6:23887386-23887408 CGGCTGCTGCTGGGGCAGAAGGG - Intergenic
1006441277 6:34055239-34055261 CTGGTGTTCCTGAGAGAGAAGGG - Intronic
1006471127 6:34229384-34229406 CAGCTGGTCCTGGGTGGAAAGGG + Intergenic
1006670104 6:35725068-35725090 CCCATGCTCCTGGGGGAGAAAGG + Intronic
1006993252 6:38233734-38233756 CTGCCTGTCCTGGTTGAGAAAGG - Intronic
1008304577 6:49886062-49886084 CTCCTGGTCCTGGGCCAGAATGG - Intergenic
1008505633 6:52226928-52226950 ATGATGCTCATGGTTGAGAAGGG - Intergenic
1012937502 6:105383563-105383585 CATCTGCTCTTGGGTGAAAAGGG + Intronic
1014064585 6:117110424-117110446 CTGCTGCTGCTGCTTCAGAAAGG + Intergenic
1015942146 6:138463305-138463327 TAGTTGCTCCTGGGTGAGATGGG - Intronic
1016120516 6:140337457-140337479 CTGGGGCTCCTGGATGATAATGG + Intergenic
1016932518 6:149425082-149425104 CTGCTGTGCCAGGCTGAGAAAGG + Intergenic
1019351734 7:557166-557188 CTGCTGATCCTGGTGGAGATGGG - Intronic
1019471488 7:1223837-1223859 CTACTGCTCATGGGAGAGGAAGG - Intergenic
1019483663 7:1277702-1277724 CTGCTCCTCTTGGCAGAGAATGG - Intergenic
1019617776 7:1974006-1974028 CTTCTGCTTCTGGGAGTGAAGGG + Intronic
1020440590 7:8212754-8212776 CTGCTGCTCCTGACTGGAAATGG - Intronic
1022013699 7:26330398-26330420 CTGCTGGTCCTGGGATAGAGGGG + Intronic
1023289558 7:38655461-38655483 CTCCTTCTCCTGGGTGCGCATGG - Intergenic
1023720526 7:43089001-43089023 CTGCTGCTCCAGGGTAAGAAGGG + Intergenic
1026737596 7:72959057-72959079 CTGCTGCGCAAGGGTGAGGACGG + Intergenic
1026788629 7:73317856-73317878 CTGCTGCGCAAGGGTGAGGAGGG + Intronic
1026853486 7:73738673-73738695 CTGCTGCTGCTGGGTGCGACAGG + Exonic
1026992405 7:74594592-74594614 CTGCTGCTGCTGGGGGAGCCTGG - Intronic
1027106137 7:75406011-75406033 CTGCTGCGCAAGGGTGAGGACGG - Intronic
1029467782 7:100736958-100736980 CTGCTGCTCTCGGGTGAAGAGGG + Exonic
1029598738 7:101551304-101551326 CTCCTGCTGCGGGGTGAGGAGGG + Intronic
1030597891 7:111561859-111561881 CCGCTCTTCCTCGGTGAGAAGGG + Exonic
1033887148 7:145963052-145963074 CTGCTGCTGCTGGGGAATAAGGG - Intergenic
1034731175 7:153388775-153388797 CTGCTGCTCCTGGTGGAGGGTGG - Intergenic
1035047460 7:155978054-155978076 CTGCTGCTGCTGTGTCAGAGTGG + Intergenic
1035249185 7:157585795-157585817 CTGCTGCTCCTGTGTGTGATTGG - Intronic
1035306686 7:157937579-157937601 CGGCTTCTCCTGGGTGGGAAAGG - Intronic
1035358063 7:158290691-158290713 CTGCTAGGCCTGGGTGAGAGGGG + Intronic
1035634777 8:1136371-1136393 CAGATGCTCGTGGGAGAGAAGGG + Intergenic
1036686041 8:10910953-10910975 CTGTTGCTCCTCAATGAGAATGG - Intronic
1037524109 8:19708049-19708071 CTGCTGCTCCACCCTGAGAAAGG + Intronic
1037675756 8:21049592-21049614 CTGCTTCTTCTGGGAGATAAAGG + Intergenic
1042939729 8:74095579-74095601 CTGCTGCTGCAAGGTGAGATGGG - Intergenic
1044628800 8:94259947-94259969 CTGTTGATCCTGGGCCAGAAAGG - Intronic
1044697945 8:94941972-94941994 CTGCTGCTGCTTCCTGAGAAAGG - Intronic
1045695295 8:104802357-104802379 CCACTGCTCCTGGGATAGAAGGG - Intronic
1049075211 8:140390404-140390426 ATGATGCTCCAGGATGAGAATGG - Intronic
1049198838 8:141330008-141330030 CCGCTGCTCCTCTGTGAAAATGG + Intergenic
1052080651 9:24202178-24202200 CTGTTGCTCATGGTTGAGGAAGG + Intergenic
1052756910 9:32551065-32551087 CTGCTGCGCATGCGTGAGGAAGG - Intronic
1055479095 9:76692385-76692407 CTCCTGCTCCCGAGTGAGACTGG + Intronic
1059387017 9:113972540-113972562 CTCCTGCTTCTTGGTGGGAAGGG + Intronic
1061050187 9:128190837-128190859 CTGCTGCTGCTGGCTGAACATGG + Exonic
1061196187 9:129108398-129108420 CTCCTCTTCCAGGGTGAGAAAGG - Intronic
1061369964 9:130192634-130192656 CTGGTGTTCCTGGGTGGGCAGGG - Intronic
1061633237 9:131887403-131887425 CTGGTGCGCATGGGTGAAAAAGG + Intronic
1062282983 9:135760193-135760215 CTGCTGCACCTGGCTGTGGATGG - Intronic
1062634224 9:137481499-137481521 CTGGCGCCCCTGGTTGAGAAGGG - Intronic
1203791082 EBV:151887-151909 CTGCTCTTCCTGGGTGAGGCCGG - Intergenic
1185460878 X:332350-332372 CTGCTGCTCCTGGGTGGACCCGG + Intergenic
1186496331 X:10015182-10015204 CCGCGGGGCCTGGGTGAGAACGG + Intergenic
1188823318 X:34800748-34800770 CTTCTTCTCCTGGTTGAGCAGGG - Intergenic
1189509302 X:41645983-41646005 CTTCTTCTCCTGGTTGAGCAGGG - Intronic
1189557860 X:42164029-42164051 CTTCTTCTCCTGGTTGAGCAGGG + Intergenic
1189597047 X:42579055-42579077 CTGGTGCTGCTGGGTGTGAAAGG + Intergenic
1192207048 X:69103231-69103253 CTGGTGAACCTGGGGGAGAAGGG - Intergenic
1193944857 X:87722807-87722829 CTGGTGGTCCTTGGTGAGAATGG + Intergenic
1195177377 X:102323774-102323796 CTGCTGCTCCTGGGAGAGGGAGG - Exonic
1195181487 X:102363319-102363341 CTGCTGCTCCTGGGAGAGGGAGG + Exonic
1195615095 X:106905836-106905858 CTGCTGCTCAGGGGAGTGAAGGG - Intronic
1199927156 X:152479833-152479855 CTCCTTCTCCTGGGTGCGCACGG - Intergenic
1200155421 X:153972387-153972409 CTGCGGCTGCTGGGTGTGCAGGG - Exonic