ID: 971476769

View in Genome Browser
Species Human (GRCh38)
Location 4:27080069-27080091
Sequence CTTCCCTCCTAGAACTCTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971476769_971476771 -5 Left 971476769 4:27080069-27080091 CCTTCAGAGTTCTAGGAGGGAAG No data
Right 971476771 4:27080087-27080109 GGAAGGTGCCTGCACAGACAAGG No data
971476769_971476774 14 Left 971476769 4:27080069-27080091 CCTTCAGAGTTCTAGGAGGGAAG No data
Right 971476774 4:27080106-27080128 AAGGAGTCCAGCTGCCTTCTGGG No data
971476769_971476773 13 Left 971476769 4:27080069-27080091 CCTTCAGAGTTCTAGGAGGGAAG No data
Right 971476773 4:27080105-27080127 CAAGGAGTCCAGCTGCCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971476769 Original CRISPR CTTCCCTCCTAGAACTCTGA AGG (reversed) Intergenic
No off target data available for this crispr