ID: 971480536

View in Genome Browser
Species Human (GRCh38)
Location 4:27110708-27110730
Sequence CTCTGGGAATCCCACTCAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971480536_971480542 5 Left 971480536 4:27110708-27110730 CCTCCTGAGTGGGATTCCCAGAG No data
Right 971480542 4:27110736-27110758 CTTGTCCCTTATACTATCTGAGG No data
971480536_971480546 19 Left 971480536 4:27110708-27110730 CCTCCTGAGTGGGATTCCCAGAG No data
Right 971480546 4:27110750-27110772 TATCTGAGGGTGCAGCCAGAAGG No data
971480536_971480543 6 Left 971480536 4:27110708-27110730 CCTCCTGAGTGGGATTCCCAGAG No data
Right 971480543 4:27110737-27110759 TTGTCCCTTATACTATCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971480536 Original CRISPR CTCTGGGAATCCCACTCAGG AGG (reversed) Intergenic
No off target data available for this crispr