ID: 971480575

View in Genome Browser
Species Human (GRCh38)
Location 4:27111001-27111023
Sequence GCCTCAGCCCGCCTCCACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971480575_971480586 16 Left 971480575 4:27111001-27111023 CCTGGGTGGAGGCGGGCTGAGGC No data
Right 971480586 4:27111040-27111062 CCCAAGTGAGGACGGGGCAGGGG No data
971480575_971480581 10 Left 971480575 4:27111001-27111023 CCTGGGTGGAGGCGGGCTGAGGC No data
Right 971480581 4:27111034-27111056 GTCAGCCCCAAGTGAGGACGGGG No data
971480575_971480580 9 Left 971480575 4:27111001-27111023 CCTGGGTGGAGGCGGGCTGAGGC No data
Right 971480580 4:27111033-27111055 TGTCAGCCCCAAGTGAGGACGGG No data
971480575_971480578 4 Left 971480575 4:27111001-27111023 CCTGGGTGGAGGCGGGCTGAGGC No data
Right 971480578 4:27111028-27111050 AATGGTGTCAGCCCCAAGTGAGG No data
971480575_971480584 15 Left 971480575 4:27111001-27111023 CCTGGGTGGAGGCGGGCTGAGGC No data
Right 971480584 4:27111039-27111061 CCCCAAGTGAGGACGGGGCAGGG No data
971480575_971480579 8 Left 971480575 4:27111001-27111023 CCTGGGTGGAGGCGGGCTGAGGC No data
Right 971480579 4:27111032-27111054 GTGTCAGCCCCAAGTGAGGACGG No data
971480575_971480582 14 Left 971480575 4:27111001-27111023 CCTGGGTGGAGGCGGGCTGAGGC No data
Right 971480582 4:27111038-27111060 GCCCCAAGTGAGGACGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971480575 Original CRISPR GCCTCAGCCCGCCTCCACCC AGG (reversed) Intergenic