ID: 971480577

View in Genome Browser
Species Human (GRCh38)
Location 4:27111023-27111045
Sequence CTTGGGGCTGACACCATTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971480577_971480586 -6 Left 971480577 4:27111023-27111045 CCTAAAATGGTGTCAGCCCCAAG No data
Right 971480586 4:27111040-27111062 CCCAAGTGAGGACGGGGCAGGGG No data
971480577_971480584 -7 Left 971480577 4:27111023-27111045 CCTAAAATGGTGTCAGCCCCAAG No data
Right 971480584 4:27111039-27111061 CCCCAAGTGAGGACGGGGCAGGG No data
971480577_971480588 17 Left 971480577 4:27111023-27111045 CCTAAAATGGTGTCAGCCCCAAG No data
Right 971480588 4:27111063-27111085 TTTCATAGTCTCCTGTAAACAGG No data
971480577_971480582 -8 Left 971480577 4:27111023-27111045 CCTAAAATGGTGTCAGCCCCAAG No data
Right 971480582 4:27111038-27111060 GCCCCAAGTGAGGACGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971480577 Original CRISPR CTTGGGGCTGACACCATTTT AGG (reversed) Intergenic