ID: 971480582

View in Genome Browser
Species Human (GRCh38)
Location 4:27111038-27111060
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971480577_971480582 -8 Left 971480577 4:27111023-27111045 CCTAAAATGGTGTCAGCCCCAAG No data
Right 971480582 4:27111038-27111060 GCCCCAAGTGAGGACGGGGCAGG No data
971480575_971480582 14 Left 971480575 4:27111001-27111023 CCTGGGTGGAGGCGGGCTGAGGC No data
Right 971480582 4:27111038-27111060 GCCCCAAGTGAGGACGGGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type