ID: 971480922

View in Genome Browser
Species Human (GRCh38)
Location 4:27114423-27114445
Sequence GAGAGCTGTACGCAGGCCCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971480922_971480925 -7 Left 971480922 4:27114423-27114445 CCCAGGGCCTGCGTACAGCTCTC No data
Right 971480925 4:27114439-27114461 AGCTCTCCCAGTCCAACTCCAGG No data
971480922_971480930 12 Left 971480922 4:27114423-27114445 CCCAGGGCCTGCGTACAGCTCTC No data
Right 971480930 4:27114458-27114480 CAGGCTATTTCTAAAGCCTGAGG No data
971480922_971480931 13 Left 971480922 4:27114423-27114445 CCCAGGGCCTGCGTACAGCTCTC No data
Right 971480931 4:27114459-27114481 AGGCTATTTCTAAAGCCTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971480922 Original CRISPR GAGAGCTGTACGCAGGCCCT GGG (reversed) Intergenic
No off target data available for this crispr