ID: 971483882

View in Genome Browser
Species Human (GRCh38)
Location 4:27140087-27140109
Sequence CTAGATTCCCTGCTTTAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971483879_971483882 7 Left 971483879 4:27140057-27140079 CCATTGAATGAAGATAGAAAGTA No data
Right 971483882 4:27140087-27140109 CTAGATTCCCTGCTTTAAATGGG No data
971483877_971483882 16 Left 971483877 4:27140048-27140070 CCAACCATGCCATTGAATGAAGA 0: 1
1: 0
2: 0
3: 9
4: 99
Right 971483882 4:27140087-27140109 CTAGATTCCCTGCTTTAAATGGG No data
971483878_971483882 12 Left 971483878 4:27140052-27140074 CCATGCCATTGAATGAAGATAGA No data
Right 971483882 4:27140087-27140109 CTAGATTCCCTGCTTTAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971483882 Original CRISPR CTAGATTCCCTGCTTTAAAT GGG Intergenic
No off target data available for this crispr