ID: 971488103

View in Genome Browser
Species Human (GRCh38)
Location 4:27182139-27182161
Sequence TTCAGGGTTTGCAGTGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971488103_971488107 12 Left 971488103 4:27182139-27182161 CCATTTTCACTGCAAACCCTGAA No data
Right 971488107 4:27182174-27182196 TGGTGTTGCTTTTACCCTCTAGG No data
971488103_971488104 -8 Left 971488103 4:27182139-27182161 CCATTTTCACTGCAAACCCTGAA No data
Right 971488104 4:27182154-27182176 ACCCTGAAGTGTAATTCTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971488103 Original CRISPR TTCAGGGTTTGCAGTGAAAA TGG (reversed) Intergenic
No off target data available for this crispr