ID: 971490533

View in Genome Browser
Species Human (GRCh38)
Location 4:27207753-27207775
Sequence CAGTATCTAGAGATGGAATC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 166
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 154}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971490528_971490533 -2 Left 971490528 4:27207732-27207754 CCAATTACAGAGCCTTCCCTGCA 0: 1
1: 0
2: 1
3: 20
4: 173
Right 971490533 4:27207753-27207775 CAGTATCTAGAGATGGAATCAGG 0: 1
1: 0
2: 0
3: 11
4: 154

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971490533 Original CRISPR CAGTATCTAGAGATGGAATC AGG Intergenic
901438090 1:9261752-9261774 CAGTATCTACAGAGGCAATCTGG + Intronic
904224329 1:29002538-29002560 CATAATCTAGAGATGCATTCTGG + Intronic
905706884 1:40067290-40067312 TAGTTTTTAGAGCTGGAATCAGG + Intronic
906074006 1:43038524-43038546 CAGGACCAAGAGATGTAATCAGG - Intergenic
911518961 1:98905747-98905769 CAGTAACTAGAGATCAAATTAGG - Intronic
911616623 1:100019610-100019632 CAGTTTCAGGAGATGGAATGAGG - Intronic
916663269 1:166942361-166942383 GAGTAGCTAGAGATGTCATCAGG + Intronic
917078594 1:171233324-171233346 CAGTATTTACAGATGGAAAAAGG + Intergenic
920461989 1:206147763-206147785 CAATATCTAGGTATGGAATTTGG - Intergenic
921306539 1:213802855-213802877 CAGTATCTAGTGAAAGAACCGGG + Intergenic
923246194 1:232135112-232135134 CAGTACCTAGGGATGGGAACTGG + Intergenic
923385349 1:233460524-233460546 CAGTCGCTAGAGTTGGAATATGG + Intergenic
1063180718 10:3596622-3596644 CAGTTTCTAGAGGAGGAAACGGG - Intergenic
1063572031 10:7224356-7224378 CAGAATTTACACATGGAATCTGG + Intronic
1066091818 10:32030048-32030070 CAGCATCTAGAGTTGCACTCAGG - Intronic
1068834285 10:61535384-61535406 CAGTCTCTAGATGTGGAATTTGG - Intergenic
1070091716 10:73292901-73292923 CAGAATCTTGACCTGGAATCAGG - Intronic
1070324390 10:75378405-75378427 CAGTGACCAGAGATGCAATCTGG - Intergenic
1072856197 10:98949526-98949548 CAGAGTTTACAGATGGAATCAGG + Intronic
1072868783 10:99093858-99093880 GATTATCTAGAGATGGACACAGG - Intronic
1073606543 10:104901330-104901352 AAGTATCTAGTGGTGGAACCAGG + Intronic
1074165542 10:110871508-110871530 CAGTTTCTAGAAATGGAGGCAGG + Intergenic
1074392480 10:113069621-113069643 CATTATTTAGAAATGGAATTGGG + Intronic
1078673897 11:13391176-13391198 CAGTAAGTAGATATGGAACCAGG - Intronic
1080033583 11:27688115-27688137 GAGAATCTAGAGAGGCAATCTGG + Intronic
1080230032 11:30010829-30010851 GAGTATCTAGAGATGGAAGAAGG - Exonic
1080371715 11:31654810-31654832 CTGTATCTAGAGATGGGAGCAGG + Intronic
1083948179 11:65937757-65937779 CAGTAAATAGAGTAGGAATCAGG - Intergenic
1086402035 11:86468902-86468924 CTGTTTCCAGAGAAGGAATCTGG + Intronic
1086593841 11:88547619-88547641 CAGTCTGAAAAGATGGAATCAGG - Intronic
1086778195 11:90866627-90866649 CTGTATCTAAAGAAGGCATCAGG + Intergenic
1087729398 11:101761041-101761063 TGGTATCTAGAGGTGGAGTCTGG - Intronic
1088078284 11:105878622-105878644 AAGAATCTAGAGAGGGAGTCTGG + Intronic
1088351871 11:108898704-108898726 CAGTCTCTGTATATGGAATCTGG - Intronic
1089084707 11:115807225-115807247 ATGCAACTAGAGATGGAATCTGG + Intergenic
1090339012 11:125998836-125998858 AAGTTTCTAGAGCTGGAATGTGG + Intronic
1090391876 11:126394168-126394190 CAGTGTCTGGGGCTGGAATCTGG - Intronic
1091369831 11:135048693-135048715 TAGTATCTAAAGTTGGCATCTGG - Intergenic
1092296499 12:7203260-7203282 CAGTATCTGGGGATAGCATCTGG + Intronic
1092457249 12:8654993-8655015 CAGTATCCAAAGATAGAAGCAGG + Intronic
1092834033 12:12471353-12471375 CTGCATCTAGAAATGGAAGCAGG - Intergenic
1093551465 12:20417374-20417396 CAGTATCTAAAGATATAATTGGG - Intronic
1098194782 12:67988108-67988130 CAGGTTCTAGAGATGGATTAGGG - Intergenic
1100332137 12:93593225-93593247 CAGGATCTAGATATAGAGTCGGG - Intergenic
1100729643 12:97450210-97450232 CAGTGTGTAGTGATGAAATCAGG + Intergenic
1103235752 12:119371124-119371146 CTGTCTCAAGAAATGGAATCAGG - Intronic
1109004567 13:56855549-56855571 CAGTCTCTAGACATGGTAACAGG + Intergenic
1109240278 13:59878110-59878132 TAGAATCTAAAGATAGAATCTGG + Intronic
1109747615 13:66647417-66647439 GAGTATCTAGAAATGTCATCTGG - Intronic
1110441237 13:75528248-75528270 AAATTTCTAGAGGTGGAATCAGG + Intronic
1111429167 13:88129546-88129568 CATTTTCTAGAGATGAAATTTGG + Intergenic
1115254347 14:31383012-31383034 CAGTATTTAGAGCTATAATCTGG + Intronic
1117104292 14:52382586-52382608 GAGGATCTAGAGAGGCAATCTGG - Intergenic
1118138806 14:63057063-63057085 CAATGGCTAGGGATGGAATCAGG + Intronic
1127976758 15:64003251-64003273 CAGAATCTAGAGATGTGCTCTGG - Intronic
1132980718 16:2737592-2737614 AAGGCTCTAGAGACGGAATCTGG + Intergenic
1132987621 16:2776309-2776331 CAGATTCTAGAGCTGGAAACTGG - Intronic
1133512325 16:6472042-6472064 CAGTATATAGAGAAAGAATGGGG - Intronic
1133954354 16:10427494-10427516 CAGTATCTAGAAATTCACTCAGG + Intronic
1135807068 16:25552448-25552470 TAGTACATAGAGATGGAATGGGG + Intergenic
1137898153 16:52236537-52236559 CTGTATCTGGACATGGAATATGG + Intergenic
1143244427 17:5470942-5470964 CAGTATCTACATATGAAAGCTGG - Intergenic
1144353304 17:14420223-14420245 CAGGCTCTTGAGGTGGAATCGGG - Intergenic
1149075712 17:52594808-52594830 GTGTGTCTAGAAATGGAATCTGG + Intergenic
1149557981 17:57587813-57587835 CATTATTAAGAGATGGAATGGGG + Intronic
1150103301 17:62442842-62442864 CAGTCTCTAGTCATGTAATCTGG - Intronic
1150671049 17:67197655-67197677 CAGTATCCCAAGATGAAATCTGG + Intronic
1150844782 17:68644425-68644447 GAGTGTCTAGAGATGGAAAGAGG - Intergenic
1151039324 17:70840253-70840275 CAGCATCTGGAGCTGGAAGCAGG + Intergenic
1155279436 18:24223986-24224008 TAGTAACTACAGAGGGAATCGGG + Intronic
1156321395 18:36027785-36027807 CAGCATTTAGAAATGAAATCTGG - Intronic
1158149221 18:54348392-54348414 GATTATCCAGAGATGGATTCTGG - Intronic
1159719247 18:71865724-71865746 CAGTCTCCCGAGATTGAATCAGG - Intergenic
1159920882 18:74226568-74226590 CAGTATCTGGATATGGTATGAGG + Intergenic
1167027414 19:46931020-46931042 CAGTACCTACAGAGGGAATTAGG + Intronic
1167737407 19:51304171-51304193 CAGTGTATAGTGATTGAATCAGG - Intergenic
925954710 2:8951643-8951665 CAGTCTCTTAAGATTGAATCAGG - Intronic
925977987 2:9154458-9154480 CAGTTTCTTGAGATTGAATTTGG - Intergenic
932977521 2:76621906-76621928 CAGTATCCCAAGATAGAATCAGG - Intergenic
935504689 2:103885551-103885573 CAGTATCTAGAGAGGTAAAAGGG + Intergenic
935845187 2:107158421-107158443 CAGTATGAAAAGATGGAATTGGG - Intergenic
938909322 2:135871536-135871558 CAGTCTATAGAAATAGAATCAGG - Intronic
941019472 2:160392475-160392497 CACTATCTATAGTTGGGATCAGG - Intronic
941578914 2:167270002-167270024 TAGCATCTAGATATGCAATCTGG - Intergenic
943240350 2:185376731-185376753 CAGAATCTAGAGAAGCAGTCTGG + Intergenic
944839934 2:203615176-203615198 CAGTAGCTAGAGTTGGATTTAGG + Intergenic
945223606 2:207509310-207509332 CAGTATCCTGGGATGGATTCTGG + Intergenic
945901673 2:215545331-215545353 AAATGTCTGGAGATGGAATCCGG - Intergenic
948265832 2:236634764-236634786 GAGTACCTAGAGATGGCATTGGG - Intergenic
1169958443 20:11131855-11131877 CAGTATCCTCAGATGGAATGAGG + Intergenic
1170086156 20:12534693-12534715 CAGCACCTATAGATGGTATCTGG - Intergenic
1175202063 20:57284852-57284874 CAGTCTCTGGTGATGGAAGCAGG - Intergenic
1177389726 21:20451951-20451973 AAGTATCTAGATATGGCGTCTGG + Intergenic
1181741925 22:24928101-24928123 CAGTCTCTAAACATGGACTCAGG + Intergenic
1181900599 22:26152323-26152345 CAGTATGAAGATATGGACTCTGG - Intergenic
949462423 3:4307262-4307284 AAGTATCAAGAGCTGCAATCTGG + Intronic
950591157 3:13936349-13936371 CAGTACACAGAGATGGAAACAGG - Intergenic
951033074 3:17904426-17904448 CAGTAGCTAAAGATTGAATAAGG + Intronic
952659895 3:35833042-35833064 CATTCTCTGGAGGTGGAATCAGG + Intergenic
955433377 3:58872909-58872931 CAGTATCCAGAATAGGAATCCGG - Intronic
955619643 3:60848874-60848896 AAGTATGTAGACATGGAATTGGG - Intronic
959956535 3:112244767-112244789 CTGTATCCACAGATGGAATTAGG + Intronic
960232047 3:115239769-115239791 CAGGATCCAGAAATGGCATCTGG - Intergenic
962653492 3:137519073-137519095 CCATATCTAGAGATGTGATCAGG - Intergenic
962840500 3:139228128-139228150 CTGTCTCGAGACATGGAATCTGG + Intronic
964028315 3:152105088-152105110 CAGTATTTAGAGATGTACTCCGG - Intergenic
964077156 3:152705852-152705874 CAGTTTCTAGAGATGGTAAAGGG - Intergenic
966443367 3:179973200-179973222 CATTAAGTAGAGATGGAATGTGG + Intronic
967522360 3:190448046-190448068 TGGTATGTAGAAATGGAATCTGG - Intronic
968567989 4:1324977-1324999 CAGCATCTAAATATGGATTCAGG - Intronic
969897059 4:10315314-10315336 AAGTGTCTAGAGATGGAGTCAGG + Intergenic
970067295 4:12113128-12113150 CAATATCCAAAGATGGAATCAGG - Intergenic
970122752 4:12775205-12775227 AAGTAGCTAGAGATGGAAGATGG - Intergenic
971490533 4:27207753-27207775 CAGTATCTAGAGATGGAATCAGG + Intergenic
971535418 4:27742340-27742362 CATTATCTAGAGATGGCTTCAGG + Intergenic
973060599 4:45719091-45719113 GTGGATCTAGAGATGTAATCTGG - Intergenic
973837515 4:54825133-54825155 AAGAATCTAGAGAGGGAATCTGG - Intergenic
975638811 4:76478411-76478433 CAGAATCTAGAGAGGCAGTCTGG - Intronic
976534306 4:86193459-86193481 CAGAATCTAGAGAGGCAGTCTGG + Intronic
978561661 4:110040641-110040663 CAGCATCGAAAGATGGAACCTGG + Intergenic
979031134 4:115649066-115649088 CAGTACCTAGAAATGGGACCAGG - Intergenic
980990115 4:139731891-139731913 AAGTGTCTAGAAATTGAATCTGG - Intronic
981553713 4:145968103-145968125 CAGAATCTAGAGAGGCAGTCTGG + Intergenic
982931321 4:161411115-161411137 CAATCTCTCGAGATCGAATCAGG + Intronic
986132811 5:4946608-4946630 CAGGATCTGGACATGGAGTCTGG + Intergenic
989825011 5:45843160-45843182 CAATACCTAAAGATGGAATTGGG - Intergenic
990965953 5:61448009-61448031 CATTATCCAGATATGGTATCTGG + Intronic
991397731 5:66222560-66222582 AAGAATCTAGAGATGCAGTCTGG + Intergenic
991520614 5:67493254-67493276 CAGTATCTACTGTTGGAACCAGG + Intergenic
993728785 5:91398178-91398200 AAGTAAAGAGAGATGGAATCTGG + Intergenic
996365340 5:122695158-122695180 CGGTTTCTGGAGATGGAATCTGG - Intergenic
996485095 5:124024295-124024317 CAGTAACTAGAGAGGGCAGCTGG - Intergenic
999502356 5:152160014-152160036 AGGAATCTAGAGAGGGAATCTGG + Intergenic
999512775 5:152270129-152270151 CAGAATCAAGAGATGGAGACAGG - Intergenic
1000291275 5:159873742-159873764 CACTGTCTAGAGATGGAAGGAGG - Intergenic
1000820631 5:165978751-165978773 CAGTAACAAGAAATAGAATCAGG - Intergenic
1001124647 5:169008437-169008459 CAATAGCTAGAGCTGGCATCAGG + Intronic
1001560596 5:172666552-172666574 TAGTATCTAGAGTTGGAGTGAGG + Intronic
1003348984 6:5297961-5297983 CAGTATCTAAAGCTGGATTTAGG + Intronic
1003810002 6:9768557-9768579 CAGAGTCCAGAGATGGAATTAGG - Intronic
1008629099 6:53347439-53347461 CAGAATCTACAGATAGAAACAGG - Intronic
1008688838 6:53954871-53954893 CACTTTATAGAAATGGAATCAGG + Intronic
1012538050 6:100323260-100323282 CAATATTCTGAGATGGAATCAGG - Intergenic
1012745531 6:103082483-103082505 CAGTATTTATAGATGGAAAAGGG - Intergenic
1022415079 7:30170476-30170498 CAGAATCTGGAGACAGAATCTGG + Intergenic
1023315606 7:38932935-38932957 CAGTATTTATACATGGAATGGGG + Intergenic
1026364039 7:69629581-69629603 TAGGATCTAGAGAAAGAATCAGG - Intronic
1032032491 7:128496014-128496036 CAGTCTCTAGTCATGTAATCTGG - Intronic
1034659097 7:152753669-152753691 CAGAATCCAGAGATGAAATCTGG - Intergenic
1037606603 8:20443015-20443037 CAGTAGCTAGAGAGGGAACTGGG + Intergenic
1037716176 8:21402637-21402659 CATTATCTAGAGAGGGAAAGTGG + Intergenic
1039279136 8:35963613-35963635 TATTATTTAGAGATGGAGTCTGG + Intergenic
1045440605 8:102205217-102205239 CAGTATCTACAAATGAAATTTGG + Exonic
1049396012 8:142401128-142401150 CTGGAGCTTGAGATGGAATCAGG - Intronic
1051441868 9:17093386-17093408 AAGTATGAGGAGATGGAATCTGG + Intergenic
1052679180 9:31667225-31667247 CACTTTATAGAAATGGAATCAGG - Intergenic
1055213751 9:73833294-73833316 CAGTACAAAGAGATGGAATTTGG + Intergenic
1057582991 9:96304081-96304103 CTGTATTTAGAGATGGTTTCAGG + Intergenic
1057973388 9:99578628-99578650 CAGTATCTGGAGATGTACTTGGG - Intergenic
1058194913 9:101960687-101960709 CAGCATCTAGAGAATGAATTAGG + Intergenic
1059814758 9:117900011-117900033 TAGAATCTATAGATGGAATTTGG - Intergenic
1061745344 9:132735299-132735321 CAGTTTCTAGTGATGAAAGCAGG - Intronic
1187762787 X:22606355-22606377 CACTTTCTAGTGATGGAATGAGG + Intergenic
1193706428 X:84825316-84825338 AAGTATCTAGAGGTGGAATGGGG + Intergenic
1196021793 X:110998585-110998607 CAGTATCTAGAAGAGGAATTAGG + Intronic
1196595224 X:117538251-117538273 CAGTAGCTAGTGATGTGATCAGG - Intergenic