ID: 971496390

View in Genome Browser
Species Human (GRCh38)
Location 4:27270375-27270397
Sequence TGTGATCTTAAAATATTTGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971496390_971496392 3 Left 971496390 4:27270375-27270397 CCCTCAAATATTTTAAGATCACA No data
Right 971496392 4:27270401-27270423 CAATTCAAGCATTACTTATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971496390 Original CRISPR TGTGATCTTAAAATATTTGA GGG (reversed) Intergenic
No off target data available for this crispr