ID: 971496392

View in Genome Browser
Species Human (GRCh38)
Location 4:27270401-27270423
Sequence CAATTCAAGCATTACTTATA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971496391_971496392 2 Left 971496391 4:27270376-27270398 CCTCAAATATTTTAAGATCACAA No data
Right 971496392 4:27270401-27270423 CAATTCAAGCATTACTTATAAGG No data
971496385_971496392 29 Left 971496385 4:27270349-27270371 CCCTCCTTCCAATCAATTTAATG No data
Right 971496392 4:27270401-27270423 CAATTCAAGCATTACTTATAAGG No data
971496389_971496392 4 Left 971496389 4:27270374-27270396 CCCCTCAAATATTTTAAGATCAC No data
Right 971496392 4:27270401-27270423 CAATTCAAGCATTACTTATAAGG No data
971496386_971496392 28 Left 971496386 4:27270350-27270372 CCTCCTTCCAATCAATTTAATGA No data
Right 971496392 4:27270401-27270423 CAATTCAAGCATTACTTATAAGG No data
971496390_971496392 3 Left 971496390 4:27270375-27270397 CCCTCAAATATTTTAAGATCACA No data
Right 971496392 4:27270401-27270423 CAATTCAAGCATTACTTATAAGG No data
971496387_971496392 25 Left 971496387 4:27270353-27270375 CCTTCCAATCAATTTAATGAACC No data
Right 971496392 4:27270401-27270423 CAATTCAAGCATTACTTATAAGG No data
971496384_971496392 30 Left 971496384 4:27270348-27270370 CCCCTCCTTCCAATCAATTTAAT No data
Right 971496392 4:27270401-27270423 CAATTCAAGCATTACTTATAAGG No data
971496388_971496392 21 Left 971496388 4:27270357-27270379 CCAATCAATTTAATGAACCCCTC No data
Right 971496392 4:27270401-27270423 CAATTCAAGCATTACTTATAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971496392 Original CRISPR CAATTCAAGCATTACTTATA AGG Intergenic
No off target data available for this crispr