ID: 971501261

View in Genome Browser
Species Human (GRCh38)
Location 4:27320263-27320285
Sequence CCTTCAAGGCAGTACCTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971501261_971501264 -4 Left 971501261 4:27320263-27320285 CCATGCAGGTACTGCCTTGAAGG No data
Right 971501264 4:27320282-27320304 AAGGATACACATTTTAGCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971501261 Original CRISPR CCTTCAAGGCAGTACCTGCA TGG (reversed) Intergenic
No off target data available for this crispr