ID: 971504872

View in Genome Browser
Species Human (GRCh38)
Location 4:27355654-27355676
Sequence CAGGGTAATCAAAGAGAAAC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 11 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971504872_971504887 30 Left 971504872 4:27355654-27355676 CCCGTTTCTCTTTGATTACCCTG No data
Right 971504887 4:27355707-27355729 GTGTGTGTGTTGCGGGGGGAGGG No data
971504872_971504882 23 Left 971504872 4:27355654-27355676 CCCGTTTCTCTTTGATTACCCTG No data
Right 971504882 4:27355700-27355722 TATGGGTGTGTGTGTGTTGCGGG No data
971504872_971504884 25 Left 971504872 4:27355654-27355676 CCCGTTTCTCTTTGATTACCCTG No data
Right 971504884 4:27355702-27355724 TGGGTGTGTGTGTGTTGCGGGGG No data
971504872_971504885 26 Left 971504872 4:27355654-27355676 CCCGTTTCTCTTTGATTACCCTG No data
Right 971504885 4:27355703-27355725 GGGTGTGTGTGTGTTGCGGGGGG No data
971504872_971504877 -3 Left 971504872 4:27355654-27355676 CCCGTTTCTCTTTGATTACCCTG No data
Right 971504877 4:27355674-27355696 CTGCAAAATGCTTCCTTTGTGGG No data
971504872_971504886 29 Left 971504872 4:27355654-27355676 CCCGTTTCTCTTTGATTACCCTG No data
Right 971504886 4:27355706-27355728 TGTGTGTGTGTTGCGGGGGGAGG No data
971504872_971504883 24 Left 971504872 4:27355654-27355676 CCCGTTTCTCTTTGATTACCCTG No data
Right 971504883 4:27355701-27355723 ATGGGTGTGTGTGTGTTGCGGGG No data
971504872_971504876 -4 Left 971504872 4:27355654-27355676 CCCGTTTCTCTTTGATTACCCTG No data
Right 971504876 4:27355673-27355695 CCTGCAAAATGCTTCCTTTGTGG No data
971504872_971504879 6 Left 971504872 4:27355654-27355676 CCCGTTTCTCTTTGATTACCCTG No data
Right 971504879 4:27355683-27355705 GCTTCCTTTGTGGGCTTTATGGG No data
971504872_971504881 22 Left 971504872 4:27355654-27355676 CCCGTTTCTCTTTGATTACCCTG No data
Right 971504881 4:27355699-27355721 TTATGGGTGTGTGTGTGTTGCGG No data
971504872_971504878 5 Left 971504872 4:27355654-27355676 CCCGTTTCTCTTTGATTACCCTG No data
Right 971504878 4:27355682-27355704 TGCTTCCTTTGTGGGCTTTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971504872 Original CRISPR CAGGGTAATCAAAGAGAAAC GGG (reversed) Intergenic
No off target data available for this crispr