ID: 971505120

View in Genome Browser
Species Human (GRCh38)
Location 4:27358310-27358332
Sequence GGGTGCTCTAAGTTGCTAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971505113_971505120 27 Left 971505113 4:27358260-27358282 CCTTATCCTCCTTTCAGAAGTTC No data
Right 971505120 4:27358310-27358332 GGGTGCTCTAAGTTGCTAGTGGG No data
971505118_971505120 -9 Left 971505118 4:27358296-27358318 CCACATGCAAGCTTGGGTGCTCT No data
Right 971505120 4:27358310-27358332 GGGTGCTCTAAGTTGCTAGTGGG No data
971505115_971505120 18 Left 971505115 4:27358269-27358291 CCTTTCAGAAGTTCAATGTTCTT No data
Right 971505120 4:27358310-27358332 GGGTGCTCTAAGTTGCTAGTGGG No data
971505114_971505120 21 Left 971505114 4:27358266-27358288 CCTCCTTTCAGAAGTTCAATGTT No data
Right 971505120 4:27358310-27358332 GGGTGCTCTAAGTTGCTAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971505120 Original CRISPR GGGTGCTCTAAGTTGCTAGT GGG Intergenic
No off target data available for this crispr