ID: 971512226

View in Genome Browser
Species Human (GRCh38)
Location 4:27440955-27440977
Sequence CAGGTGACTCAGAGGACACA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971512222_971512226 25 Left 971512222 4:27440907-27440929 CCACAAATAGATAAAACGGTTGC No data
Right 971512226 4:27440955-27440977 CAGGTGACTCAGAGGACACATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971512226 Original CRISPR CAGGTGACTCAGAGGACACA TGG Intergenic
No off target data available for this crispr