ID: 971513398

View in Genome Browser
Species Human (GRCh38)
Location 4:27456029-27456051
Sequence CCTTACATGGAGATATTTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971513392_971513398 9 Left 971513392 4:27455997-27456019 CCAAAGTCTTACATGTTATAATA No data
Right 971513398 4:27456029-27456051 CCTTACATGGAGATATTTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971513398 Original CRISPR CCTTACATGGAGATATTTGA GGG Intergenic
No off target data available for this crispr