ID: 971514540

View in Genome Browser
Species Human (GRCh38)
Location 4:27469868-27469890
Sequence TAGTCCTTTAATATAATTTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971514540_971514543 26 Left 971514540 4:27469868-27469890 CCAGAAATTATATTAAAGGACTA No data
Right 971514543 4:27469917-27469939 AAACTTGAGACTACCAGATTTGG No data
971514540_971514542 0 Left 971514540 4:27469868-27469890 CCAGAAATTATATTAAAGGACTA No data
Right 971514542 4:27469891-27469913 GTTAGTTACTTAGTTTTTAAGGG No data
971514540_971514541 -1 Left 971514540 4:27469868-27469890 CCAGAAATTATATTAAAGGACTA No data
Right 971514541 4:27469890-27469912 AGTTAGTTACTTAGTTTTTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971514540 Original CRISPR TAGTCCTTTAATATAATTTC TGG (reversed) Intergenic
No off target data available for this crispr