ID: 971523539

View in Genome Browser
Species Human (GRCh38)
Location 4:27586157-27586179
Sequence CTTGCAGTCCTGTTACATTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971523539_971523550 28 Left 971523539 4:27586157-27586179 CCACAATGTAACAGGACTGCAAG No data
Right 971523550 4:27586208-27586230 CATGCAGTCTTCCCCTCCCTGGG No data
971523539_971523549 27 Left 971523539 4:27586157-27586179 CCACAATGTAACAGGACTGCAAG No data
Right 971523549 4:27586207-27586229 CCATGCAGTCTTCCCCTCCCTGG No data
971523539_971523541 0 Left 971523539 4:27586157-27586179 CCACAATGTAACAGGACTGCAAG No data
Right 971523541 4:27586180-27586202 GTGCACACTTCCCCCCTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971523539 Original CRISPR CTTGCAGTCCTGTTACATTG TGG (reversed) Intergenic
No off target data available for this crispr