ID: 971525597

View in Genome Browser
Species Human (GRCh38)
Location 4:27613817-27613839
Sequence TAGGGTGCCAGGCAGGATGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971525597_971525604 7 Left 971525597 4:27613817-27613839 CCCACATCCTGCCTGGCACCCTA No data
Right 971525604 4:27613847-27613869 TCCTCACCATTCTGCCTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971525597 Original CRISPR TAGGGTGCCAGGCAGGATGT GGG (reversed) Intergenic
No off target data available for this crispr