ID: 971528116

View in Genome Browser
Species Human (GRCh38)
Location 4:27648398-27648420
Sequence CCTTATATTAAGAGGGAATT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971528116_971528123 13 Left 971528116 4:27648398-27648420 CCAAATTCCCTCTTAATATAAGG No data
Right 971528123 4:27648434-27648456 TAGATTAGGGTTCAACCTAATGG No data
971528116_971528121 0 Left 971528116 4:27648398-27648420 CCAAATTCCCTCTTAATATAAGG No data
Right 971528121 4:27648421-27648443 ACACCAGTCAGAATAGATTAGGG No data
971528116_971528120 -1 Left 971528116 4:27648398-27648420 CCAAATTCCCTCTTAATATAAGG No data
Right 971528120 4:27648420-27648442 GACACCAGTCAGAATAGATTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971528116 Original CRISPR CCTTATATTAAGAGGGAATT TGG (reversed) Intergenic
No off target data available for this crispr