ID: 971533839

View in Genome Browser
Species Human (GRCh38)
Location 4:27722801-27722823
Sequence TTGCTGACCTTCTGTGTAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971533834_971533839 8 Left 971533834 4:27722770-27722792 CCCTCCTTCTAGTTACTTGGTAG No data
Right 971533839 4:27722801-27722823 TTGCTGACCTTCTGTGTAGGTGG No data
971533837_971533839 4 Left 971533837 4:27722774-27722796 CCTTCTAGTTACTTGGTAGGATT No data
Right 971533839 4:27722801-27722823 TTGCTGACCTTCTGTGTAGGTGG No data
971533835_971533839 7 Left 971533835 4:27722771-27722793 CCTCCTTCTAGTTACTTGGTAGG No data
Right 971533839 4:27722801-27722823 TTGCTGACCTTCTGTGTAGGTGG No data
971533832_971533839 23 Left 971533832 4:27722755-27722777 CCATGTCTGGTTCTTCCCTCCTT No data
Right 971533839 4:27722801-27722823 TTGCTGACCTTCTGTGTAGGTGG No data
971533831_971533839 24 Left 971533831 4:27722754-27722776 CCCATGTCTGGTTCTTCCCTCCT No data
Right 971533839 4:27722801-27722823 TTGCTGACCTTCTGTGTAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971533839 Original CRISPR TTGCTGACCTTCTGTGTAGG TGG Intergenic
No off target data available for this crispr