ID: 971535158

View in Genome Browser
Species Human (GRCh38)
Location 4:27738783-27738805
Sequence TAATTCCCACACATTGTGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 8889
Summary {0: 5, 1: 91, 2: 975, 3: 2875, 4: 4943}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971535158_971535163 1 Left 971535158 4:27738783-27738805 CCTCCCACAATGTGTGGGAATTA 0: 5
1: 91
2: 975
3: 2875
4: 4943
Right 971535163 4:27738807-27738829 GGGAGCTACAAACTGAGATTTGG No data
971535158_971535164 2 Left 971535158 4:27738783-27738805 CCTCCCACAATGTGTGGGAATTA 0: 5
1: 91
2: 975
3: 2875
4: 4943
Right 971535164 4:27738808-27738830 GGAGCTACAAACTGAGATTTGGG No data
971535158_971535165 7 Left 971535158 4:27738783-27738805 CCTCCCACAATGTGTGGGAATTA 0: 5
1: 91
2: 975
3: 2875
4: 4943
Right 971535165 4:27738813-27738835 TACAAACTGAGATTTGGGTGAGG No data
971535158_971535166 30 Left 971535158 4:27738783-27738805 CCTCCCACAATGTGTGGGAATTA 0: 5
1: 91
2: 975
3: 2875
4: 4943
Right 971535166 4:27738836-27738858 ACACAGAGCCAAACCTTATCAGG 0: 4
1: 233
2: 438
3: 546
4: 1162

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971535158 Original CRISPR TAATTCCCACACATTGTGGG AGG (reversed) Intergenic
Too many off-targets to display for this crispr