ID: 971539382

View in Genome Browser
Species Human (GRCh38)
Location 4:27796520-27796542
Sequence TAGGACCACCAAAGTGAACC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971539378_971539382 29 Left 971539378 4:27796468-27796490 CCGGGTCAGTGATGCACAGAGAA No data
Right 971539382 4:27796520-27796542 TAGGACCACCAAAGTGAACCTGG No data
971539380_971539382 -3 Left 971539380 4:27796500-27796522 CCAAAACTTGGACAAATCTGTAG No data
Right 971539382 4:27796520-27796542 TAGGACCACCAAAGTGAACCTGG No data
971539377_971539382 30 Left 971539377 4:27796467-27796489 CCCGGGTCAGTGATGCACAGAGA No data
Right 971539382 4:27796520-27796542 TAGGACCACCAAAGTGAACCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971539382 Original CRISPR TAGGACCACCAAAGTGAACC TGG Intergenic
No off target data available for this crispr