ID: 971542844

View in Genome Browser
Species Human (GRCh38)
Location 4:27842825-27842847
Sequence ATGGAGAAACATAATGTGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971542838_971542844 4 Left 971542838 4:27842798-27842820 CCTCCCTATATGAAGATCATTTC No data
Right 971542844 4:27842825-27842847 ATGGAGAAACATAATGTGGAGGG No data
971542839_971542844 1 Left 971542839 4:27842801-27842823 CCCTATATGAAGATCATTTCGCA No data
Right 971542844 4:27842825-27842847 ATGGAGAAACATAATGTGGAGGG No data
971542840_971542844 0 Left 971542840 4:27842802-27842824 CCTATATGAAGATCATTTCGCAA No data
Right 971542844 4:27842825-27842847 ATGGAGAAACATAATGTGGAGGG No data
971542837_971542844 5 Left 971542837 4:27842797-27842819 CCCTCCCTATATGAAGATCATTT No data
Right 971542844 4:27842825-27842847 ATGGAGAAACATAATGTGGAGGG No data
971542836_971542844 6 Left 971542836 4:27842796-27842818 CCCCTCCCTATATGAAGATCATT No data
Right 971542844 4:27842825-27842847 ATGGAGAAACATAATGTGGAGGG No data
971542835_971542844 11 Left 971542835 4:27842791-27842813 CCACACCCCTCCCTATATGAAGA No data
Right 971542844 4:27842825-27842847 ATGGAGAAACATAATGTGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971542844 Original CRISPR ATGGAGAAACATAATGTGGA GGG Intergenic
No off target data available for this crispr