ID: 971543400

View in Genome Browser
Species Human (GRCh38)
Location 4:27851690-27851712
Sequence CTGCATTCCATTGGCAAAAC GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971543393_971543400 20 Left 971543393 4:27851647-27851669 CCAACCTAATCTACGTCTAAAAG No data
Right 971543400 4:27851690-27851712 CTGCATTCCATTGGCAAAACGGG No data
971543395_971543400 -3 Left 971543395 4:27851670-27851692 CCTCAGCTCATATCCAGTACCTG No data
Right 971543400 4:27851690-27851712 CTGCATTCCATTGGCAAAACGGG No data
971543394_971543400 16 Left 971543394 4:27851651-27851673 CCTAATCTACGTCTAAAAGCCTC No data
Right 971543400 4:27851690-27851712 CTGCATTCCATTGGCAAAACGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971543400 Original CRISPR CTGCATTCCATTGGCAAAAC GGG Intergenic
No off target data available for this crispr