ID: 971545730

View in Genome Browser
Species Human (GRCh38)
Location 4:27883067-27883089
Sequence GGTGAACTGCTCCACGCAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971545727_971545730 29 Left 971545727 4:27883015-27883037 CCTTAGGTAGCATTAGCTAGCGT No data
Right 971545730 4:27883067-27883089 GGTGAACTGCTCCACGCAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971545730 Original CRISPR GGTGAACTGCTCCACGCAGA AGG Intergenic
No off target data available for this crispr