ID: 971546205

View in Genome Browser
Species Human (GRCh38)
Location 4:27890522-27890544
Sequence CAAAATGTTGATAGTGATAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971546203_971546205 4 Left 971546203 4:27890495-27890517 CCTAGAGATTTGTTGAATGGCTT No data
Right 971546205 4:27890522-27890544 CAAAATGTTGATAGTGATATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971546205 Original CRISPR CAAAATGTTGATAGTGATAT GGG Intergenic