ID: 971546407

View in Genome Browser
Species Human (GRCh38)
Location 4:27891929-27891951
Sequence CATCAGAGGGACTCAGTGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971546398_971546407 -5 Left 971546398 4:27891911-27891933 CCCATAATCCCCATGTGTCATCA No data
Right 971546407 4:27891929-27891951 CATCAGAGGGACTCAGTGGGAGG No data
971546395_971546407 26 Left 971546395 4:27891880-27891902 CCTCACCCAAATCTTATCTTGAA 0: 342
1: 8118
2: 11480
3: 9509
4: 7232
Right 971546407 4:27891929-27891951 CATCAGAGGGACTCAGTGGGAGG No data
971546399_971546407 -6 Left 971546399 4:27891912-27891934 CCATAATCCCCATGTGTCATCAG No data
Right 971546407 4:27891929-27891951 CATCAGAGGGACTCAGTGGGAGG No data
971546396_971546407 21 Left 971546396 4:27891885-27891907 CCCAAATCTTATCTTGAATTGTT No data
Right 971546407 4:27891929-27891951 CATCAGAGGGACTCAGTGGGAGG No data
971546397_971546407 20 Left 971546397 4:27891886-27891908 CCAAATCTTATCTTGAATTGTTG No data
Right 971546407 4:27891929-27891951 CATCAGAGGGACTCAGTGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971546407 Original CRISPR CATCAGAGGGACTCAGTGGG AGG Intergenic
No off target data available for this crispr