ID: 971549825

View in Genome Browser
Species Human (GRCh38)
Location 4:27938880-27938902
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971549825_971549829 17 Left 971549825 4:27938880-27938902 CCACTTTTAACCCAGGATGGTCT No data
Right 971549829 4:27938920-27938942 CAAGCAAGAAAATCACCTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971549825 Original CRISPR AGACCATCCTGGGTTAAAAG TGG (reversed) Intergenic
No off target data available for this crispr