ID: 971551234

View in Genome Browser
Species Human (GRCh38)
Location 4:27958766-27958788
Sequence CAGGGTAATCAGAGCAATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971551234_971551238 12 Left 971551234 4:27958766-27958788 CCAGCATTGCTCTGATTACCCTG No data
Right 971551238 4:27958801-27958823 AGCAAAGATACTACTAGAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971551234 Original CRISPR CAGGGTAATCAGAGCAATGC TGG (reversed) Intergenic
No off target data available for this crispr