ID: 971557065

View in Genome Browser
Species Human (GRCh38)
Location 4:28026088-28026110
Sequence ATCTGGTACTGTGCCTATGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971557065_971557068 28 Left 971557065 4:28026088-28026110 CCAGCATAGGCACAGTACCAGAT No data
Right 971557068 4:28026139-28026161 TGAATAAACAAAGACAGCAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971557065 Original CRISPR ATCTGGTACTGTGCCTATGC TGG (reversed) Intergenic
No off target data available for this crispr