ID: 971562206

View in Genome Browser
Species Human (GRCh38)
Location 4:28093941-28093963
Sequence GGCTCAGGAAACCCACCTTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971562206_971562210 20 Left 971562206 4:28093941-28093963 CCAAAAGGTGGGTTTCCTGAGCC No data
Right 971562210 4:28093984-28094006 GCCAGTGGAAGAAACAAATATGG No data
971562206_971562212 26 Left 971562206 4:28093941-28093963 CCAAAAGGTGGGTTTCCTGAGCC No data
Right 971562212 4:28093990-28094012 GGAAGAAACAAATATGGCCTAGG No data
971562206_971562209 5 Left 971562206 4:28093941-28093963 CCAAAAGGTGGGTTTCCTGAGCC No data
Right 971562209 4:28093969-28093991 TATTTTATAGCAGAAGCCAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971562206 Original CRISPR GGCTCAGGAAACCCACCTTT TGG (reversed) Intergenic
No off target data available for this crispr