ID: 971562210

View in Genome Browser
Species Human (GRCh38)
Location 4:28093984-28094006
Sequence GCCAGTGGAAGAAACAAATA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971562208_971562210 -1 Left 971562208 4:28093962-28093984 CCTGAGTTATTTTATAGCAGAAG No data
Right 971562210 4:28093984-28094006 GCCAGTGGAAGAAACAAATATGG No data
971562205_971562210 21 Left 971562205 4:28093940-28093962 CCCAAAAGGTGGGTTTCCTGAGC No data
Right 971562210 4:28093984-28094006 GCCAGTGGAAGAAACAAATATGG No data
971562207_971562210 5 Left 971562207 4:28093956-28093978 CCTGAGCCTGAGTTATTTTATAG No data
Right 971562210 4:28093984-28094006 GCCAGTGGAAGAAACAAATATGG No data
971562206_971562210 20 Left 971562206 4:28093941-28093963 CCAAAAGGTGGGTTTCCTGAGCC No data
Right 971562210 4:28093984-28094006 GCCAGTGGAAGAAACAAATATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971562210 Original CRISPR GCCAGTGGAAGAAACAAATA TGG Intergenic
No off target data available for this crispr