ID: 971571248

View in Genome Browser
Species Human (GRCh38)
Location 4:28213665-28213687
Sequence CTGAGAAGGAGCAATTTTGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971571246_971571248 -5 Left 971571246 4:28213647-28213669 CCACTTGTGGTTGTTTTGCTGAG No data
Right 971571248 4:28213665-28213687 CTGAGAAGGAGCAATTTTGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971571248 Original CRISPR CTGAGAAGGAGCAATTTTGC AGG Intergenic
No off target data available for this crispr