ID: 971573253

View in Genome Browser
Species Human (GRCh38)
Location 4:28241081-28241103
Sequence GAAGAAGGATGTTTGAGGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971573245_971573253 11 Left 971573245 4:28241047-28241069 CCTACAAACAGAGAAGAAAGGAA No data
Right 971573253 4:28241081-28241103 GAAGAAGGATGTTTGAGGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971573253 Original CRISPR GAAGAAGGATGTTTGAGGGA GGG Intergenic
No off target data available for this crispr