ID: 971578050

View in Genome Browser
Species Human (GRCh38)
Location 4:28302262-28302284
Sequence GACTCAGTAATCTCATGACT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971578046_971578050 8 Left 971578046 4:28302231-28302253 CCTCAAAGACCTCAAGACAGAAA No data
Right 971578050 4:28302262-28302284 GACTCAGTAATCTCATGACTGGG No data
971578047_971578050 -1 Left 971578047 4:28302240-28302262 CCTCAAGACAGAAATACCATTTG No data
Right 971578050 4:28302262-28302284 GACTCAGTAATCTCATGACTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971578050 Original CRISPR GACTCAGTAATCTCATGACT GGG Intergenic
No off target data available for this crispr