ID: 971582361

View in Genome Browser
Species Human (GRCh38)
Location 4:28358211-28358233
Sequence CTGTCAAGAGTGCTGGTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971582361_971582366 9 Left 971582361 4:28358211-28358233 CCCACCACCAGCACTCTTGACAG No data
Right 971582366 4:28358243-28358265 TCTCCAGACTTATTTGCCAAAGG No data
971582361_971582368 19 Left 971582361 4:28358211-28358233 CCCACCACCAGCACTCTTGACAG No data
Right 971582368 4:28358253-28358275 TATTTGCCAAAGGTTCCCCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971582361 Original CRISPR CTGTCAAGAGTGCTGGTGGT GGG (reversed) Intergenic
No off target data available for this crispr