ID: 971582361 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 4:28358211-28358233 |
| Sequence | CTGTCAAGAGTGCTGGTGGT GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 971582361_971582366 | 9 | Left | 971582361 | 4:28358211-28358233 | CCCACCACCAGCACTCTTGACAG | No data | ||
| Right | 971582366 | 4:28358243-28358265 | TCTCCAGACTTATTTGCCAAAGG | No data | ||||
| 971582361_971582368 | 19 | Left | 971582361 | 4:28358211-28358233 | CCCACCACCAGCACTCTTGACAG | No data | ||
| Right | 971582368 | 4:28358253-28358275 | TATTTGCCAAAGGTTCCCCGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 971582361 | Original CRISPR | CTGTCAAGAGTGCTGGTGGT GGG (reversed) | Intergenic | ||
| No off target data available for this crispr | |||||