ID: 971585043

View in Genome Browser
Species Human (GRCh38)
Location 4:28394686-28394708
Sequence AAGTGTGTGGTACCCTCCCC CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 120
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 104}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971585039_971585043 21 Left 971585039 4:28394642-28394664 CCTTGTGACAGTGAGTGAGTTTT 0: 1
1: 19
2: 84
3: 247
4: 735
Right 971585043 4:28394686-28394708 AAGTGTGTGGTACCCTCCCCCGG 0: 1
1: 0
2: 1
3: 14
4: 104
971585041_971585043 -4 Left 971585041 4:28394667-28394689 CCAAGATCTGGTTGTTTAAAAGT 0: 35
1: 59
2: 80
3: 132
4: 458
Right 971585043 4:28394686-28394708 AAGTGTGTGGTACCCTCCCCCGG 0: 1
1: 0
2: 1
3: 14
4: 104

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971585043 Original CRISPR AAGTGTGTGGTACCCTCCCC CGG Intronic
900646509 1:3711207-3711229 ACGTGTGTGGAGCGCTCCCCAGG - Intronic
901871172 1:12140171-12140193 AGGTGTGGGCTGCCCTCCCCTGG + Intronic
901874345 1:12158425-12158447 AAGTGAGTGTTACCCTTTCCAGG - Intergenic
901942956 1:12677808-12677830 AAGTGTTTGGACCTCTCCCCTGG - Intergenic
907668645 1:56454966-56454988 CAGTGTGTGGTTGCCTCCTCAGG + Intergenic
914402109 1:147331500-147331522 AAGTGTGGGGAACCCTACACTGG - Intergenic
922422912 1:225471523-225471545 AAGTGGGCGGTCCCCTCCCTGGG + Intergenic
1064228145 10:13505526-13505548 AGGGGTGTGCTACCCTCCCCGGG + Intronic
1065797087 10:29317798-29317820 AGGTGTGTGCCACCATCCCCAGG - Intronic
1071189560 10:83083334-83083356 AAGTGTGTGGTATCCCCACCTGG + Intergenic
1073151696 10:101316063-101316085 CAGTGTCTGGGCCCCTCCCCAGG + Intergenic
1076123195 10:127952652-127952674 TAGTGTGTAGGTCCCTCCCCCGG - Intronic
1076313036 10:129521730-129521752 AAGTGTGTGCTGTCCACCCCAGG + Intronic
1077216795 11:1398409-1398431 ATAGGTGTGGTACCCGCCCCGGG + Intronic
1079910984 11:26309328-26309350 AAGAGTGTGTTACCCACCCTAGG + Intergenic
1083116326 11:60463088-60463110 GACTGTGTGGTACCCTCTCTGGG + Exonic
1084382953 11:68825361-68825383 AAGTGTGTGCTTCCCTTCCTGGG - Intronic
1085837278 11:79970628-79970650 ATGTGTGTGGTACGCTCCCTCGG - Intergenic
1087267479 11:96076621-96076643 AAATGTGTGAGAACCTCCCCAGG - Intronic
1087397447 11:97619006-97619028 AAGTGTGTGGCACCCCCACCTGG + Intergenic
1088141183 11:106618513-106618535 AAGTGTGTGGCACTTCCCCCTGG - Intergenic
1089489910 11:118876356-118876378 AAGTGTGAGGAGCACTCCCCTGG + Intergenic
1089734176 11:120538384-120538406 AAGTGTCTGATTCCCTCCCCAGG + Intronic
1091015709 11:132049378-132049400 AAGGGTGTGGCTCCCTCCTCAGG - Intronic
1091242050 11:134059761-134059783 CACTGTGTGGTACACCCCCCGGG + Intergenic
1097456417 12:59804009-59804031 AAGTGTGTGGTAGCCTCTGATGG + Intergenic
1098734378 12:74080575-74080597 AAGTGAGGGGTACCCTTCACTGG - Intergenic
1099334363 12:81334939-81334961 AATTGTGTGTTACCATCCTCTGG + Intronic
1101930514 12:109009977-109009999 AGGTGTGAGCTACCCTGCCCAGG - Intronic
1107586860 13:41858931-41858953 AAGTGTGAAGCACCCTGCCCAGG - Intronic
1113074091 13:106451201-106451223 ATGCGTGTGGTTCCCTCACCTGG + Intergenic
1117234986 14:53764038-53764060 AAGTGTGTGCCACCATGCCCAGG - Intergenic
1122778917 14:104135493-104135515 AAGTGTCAGGGACCCTGCCCAGG - Intergenic
1123039243 14:105483669-105483691 AGGTGTGAGGTGCCCTCCCGGGG - Intergenic
1128733563 15:70036676-70036698 CAGTGTGAGGCACCCTCCTCTGG - Intergenic
1128766646 15:70255152-70255174 AAGAGTGTGGGACCTCCCCCCGG - Intergenic
1129175212 15:73835231-73835253 AAGTGTGTGGTACCCTACTGGGG + Intergenic
1131727707 15:95244845-95244867 AAGTGTGTGGCACCTCTCCCTGG - Intergenic
1132046532 15:98567378-98567400 CGGTGTGTGTTGCCCTCCCCCGG + Intergenic
1132106643 15:99067584-99067606 AAGTGTGGGCCACCCTCACCGGG + Intergenic
1132830127 16:1923897-1923919 AAGGATGTGGTTCCCTCCCAGGG + Intergenic
1133026675 16:2991661-2991683 CGGTCTGTGTTACCCTCCCCAGG + Intergenic
1137382927 16:48015208-48015230 AAGTGTGTGTCACCCTCCCCCGG - Intergenic
1142690958 17:1605867-1605889 AAGGGTGTGCTCCCCTCCCCCGG + Intronic
1147652218 17:42069155-42069177 AAGTGGGTGGCTCCCTCCCAGGG - Intergenic
1148757308 17:49980320-49980342 CAGAGAGTGGCACCCTCCCCTGG - Intergenic
1149616274 17:58002867-58002889 AAGTGTGTGCCACCCTTGCCCGG - Intronic
1150957003 17:69870268-69870290 CAGTGTGTGGTAGCTCCCCCAGG + Intergenic
1151090335 17:71432372-71432394 GACTGTGTGGTACTCTCACCTGG - Intergenic
1151340823 17:73469624-73469646 ACGTGTGTGGTCCCTTCCCCTGG - Intronic
1152231980 17:79118291-79118313 ACGTGTGTGCTTCCCTCCCGTGG - Intronic
1152629896 17:81406205-81406227 AAGGGTTTCGGACCCTCCCCTGG - Intronic
1154474451 18:14742435-14742457 AATGGTTTGGTTCCCTCCCCTGG - Intronic
1155605861 18:27605413-27605435 AAGTGTGTGCTGCCCTCTACTGG - Intergenic
1158146821 18:54323408-54323430 AAGAGTGTGGTACCGACACCTGG - Intergenic
1162064092 19:8114524-8114546 AGGTGTGAGCTACCCTGCCCAGG + Intronic
1166449059 19:42881828-42881850 CAGGGTGTGGTACTCTGCCCTGG - Intronic
1166455944 19:42939341-42939363 CAGGGTGTGGTACTCTGCCCTGG - Intronic
926057554 2:9783543-9783565 AAGTGTGTGGCACTTCCCCCCGG - Intergenic
926916201 2:17894312-17894334 AAGTGTGTGGCCCCCTTCCTAGG - Intronic
932440697 2:71732826-71732848 TTGTGTCTGGCACCCTCCCCTGG + Intergenic
932494703 2:72140601-72140623 AAGTGTGGGCTAGCCTTCCCCGG + Intronic
933282399 2:80346371-80346393 AAGTGTGTGGCACCTCTCCCCGG - Intronic
933678214 2:85076698-85076720 AAGTCTGCGGTTCCCTCCCAAGG - Intergenic
941974113 2:171384686-171384708 AGGTGTGTGCTACCCACACCTGG - Intronic
943627964 2:190219717-190219739 TAGTGTGCAGGACCCTCCCCCGG - Intronic
948477085 2:238227189-238227211 CAGTGTGTGGGCGCCTCCCCTGG - Intronic
1170556482 20:17518983-17519005 GAGGGTGTGGTCCCATCCCCGGG - Intronic
1172068730 20:32240480-32240502 AGGGGTGGGGTATCCTCCCCGGG - Intergenic
1174322620 20:49753986-49754008 AAGTGTGTGCCACCATGCCCAGG + Intergenic
1175709134 20:61205307-61205329 AGGTGTGTCCTGCCCTCCCCTGG + Intergenic
1181588832 22:23870310-23870332 AAATGTCTGTTCCCCTCCCCAGG + Intronic
1183976881 22:41517468-41517490 AGGTGTGTGGGACCCTGGCCCGG + Intronic
953576762 3:44119013-44119035 AAGCTTTGGGTACCCTCCCCAGG + Intergenic
953907705 3:46876628-46876650 TAATGAGTGGTACCCTCCCCAGG + Intronic
954261702 3:49443792-49443814 AAGTGTGAGCCACCCTGCCCAGG + Intergenic
962672537 3:137723755-137723777 AAGTGTGTGTCACCATCCCATGG + Intergenic
969070798 4:4537105-4537127 ACCTGTGTGGTAGCCCCCCCTGG + Intronic
970354017 4:15234537-15234559 AAGGTTGTGGAAACCTCCCCAGG - Intergenic
971585043 4:28394686-28394708 AAGTGTGTGGTACCCTCCCCCGG + Intronic
971625121 4:28910091-28910113 AAGTATGTGCTACCATGCCCGGG + Intergenic
978817634 4:112927090-112927112 ATGGGGGTGGTTCCCTCCCCAGG - Intronic
986422180 5:7596594-7596616 AGGTGTGAGGTGACCTCCCCGGG - Intronic
986541296 5:8847012-8847034 AAGTGTGTGGTAATCTGCCATGG - Intergenic
987697952 5:21356103-21356125 AAGTGTGTGGAACTTCCCCCCGG - Intergenic
991742490 5:69696280-69696302 AAGTGTGTGGAACTTCCCCCCGG + Intergenic
991755204 5:69858924-69858946 AAGTGTGTGGAACTTCCCCCCGG - Intergenic
991794064 5:70276018-70276040 AAGTGTGTGGAACTTCCCCCCGG + Intergenic
991821880 5:70571593-70571615 AAGTGTGTGGAACTTCCCCCCGG + Intergenic
991834531 5:70734072-70734094 AAGTGTGTGGAACTTCCCCCCGG - Intergenic
991886441 5:71275560-71275582 AAGTGTGTGGAACTTCCCCCCGG + Intergenic
992810659 5:80385182-80385204 AGGTGTGTGCTACCATGCCCAGG - Intergenic
998390248 5:141782926-141782948 AAGTGAGTGGGACCCTGCCCTGG - Intergenic
1000880448 5:166691211-166691233 AATTGTGGGGTCCCATCCCCAGG - Intergenic
1001947117 5:175788471-175788493 AGGTGCTTGGTCCCCTCCCCTGG - Intergenic
1005552899 6:26942297-26942319 AAGTGTGTGGAACTTCCCCCTGG + Intergenic
1011391768 6:86861754-86861776 AAGTTTGTGGTACCCTGCATTGG - Intergenic
1012247831 6:96945733-96945755 AAGTGGGTGGTAGCTTCCCGGGG + Intronic
1012511999 6:100013016-100013038 AATTGGTTGGTTCCCTCCCCTGG + Intergenic
1013760270 6:113510257-113510279 GGGTGTGTGGCACCTTCCCCCGG + Intergenic
1014913866 6:127121118-127121140 AAGTGTGTGGCTCCCAGCCCGGG - Intronic
1019321508 7:417539-417561 AGGAGTGTTGTGCCCTCCCCAGG + Intergenic
1020500331 7:8910871-8910893 AAGTCTGTGGTACTTTGCCCCGG + Intergenic
1025957017 7:66190647-66190669 AAGTGTGTTGTAACTTTCCCGGG - Intergenic
1026152076 7:67796393-67796415 ACGTGTGTGATACACTCCCCAGG - Intergenic
1029386823 7:100248822-100248844 TAGTGTGCCGTATCCTCCCCCGG + Intronic
1031916047 7:127564032-127564054 AAGTGTATGGAACCCTCCCTGGG + Intergenic
1041359268 8:57033674-57033696 TAGTGTGTATTTCCCTCCCCTGG + Intergenic
1044460216 8:92435386-92435408 AAGTATTAGGTACCCTGCCCTGG + Intergenic
1048936158 8:139358917-139358939 AAGTGTGTGTTTGTCTCCCCAGG + Intergenic
1051006531 9:12352248-12352270 AGGTGGGTTGTACCCTCCCAGGG + Intergenic
1052677370 9:31644482-31644504 AAGTGTCTGTTACCCTCACTAGG - Intergenic
1056081803 9:83102769-83102791 TATTGTCTGGTACCCTGCCCTGG + Intergenic
1056185024 9:84126024-84126046 AAGTGTTTGGCACCATCCCCTGG - Intergenic
1056820464 9:89838127-89838149 GCCTGTGTGGTGCCCTCCCCTGG + Intergenic
1060360580 9:122952590-122952612 AAGTGTGTGCCACCATGCCCAGG - Intronic
1062607637 9:137355247-137355269 CAGACTGTGGTGCCCTCCCCGGG - Intronic
1189780587 X:44510689-44510711 AGGTGTGTGCTACCATGCCCAGG + Intergenic
1193887355 X:86998817-86998839 AAGTGTGTGGTACCTCCCCATGG - Intergenic
1200958355 Y:8973054-8973076 AGGTGTGTGGTCCCCTCTTCTGG + Intergenic