ID: 971585477

View in Genome Browser
Species Human (GRCh38)
Location 4:28400646-28400668
Sequence GCAGTTTGATAGTGAAGCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 102}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971585473_971585477 10 Left 971585473 4:28400613-28400635 CCTTTTCAAGAAAGTTGATTTCC 0: 1
1: 0
2: 3
3: 31
4: 274
Right 971585477 4:28400646-28400668 GCAGTTTGATAGTGAAGCCCTGG 0: 1
1: 0
2: 0
3: 18
4: 102
971585472_971585477 11 Left 971585472 4:28400612-28400634 CCCTTTTCAAGAAAGTTGATTTC 0: 1
1: 1
2: 1
3: 39
4: 383
Right 971585477 4:28400646-28400668 GCAGTTTGATAGTGAAGCCCTGG 0: 1
1: 0
2: 0
3: 18
4: 102
971585471_971585477 20 Left 971585471 4:28400603-28400625 CCAAGATCTCCCTTTTCAAGAAA 0: 1
1: 0
2: 5
3: 30
4: 300
Right 971585477 4:28400646-28400668 GCAGTTTGATAGTGAAGCCCTGG 0: 1
1: 0
2: 0
3: 18
4: 102

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971585477 Original CRISPR GCAGTTTGATAGTGAAGCCC TGG Intronic
901303477 1:8216337-8216359 GCAGTTTGACAGTGAAGGGAAGG + Intergenic
901423000 1:9163400-9163422 TGAGCTTGAAAGTGAAGCCCTGG + Intergenic
906315579 1:44784630-44784652 GCAGGTTGAAGGTGGAGCCCAGG + Exonic
908103534 1:60815697-60815719 GCAGGATTAAAGTGAAGCCCAGG + Intergenic
909454862 1:75838793-75838815 GCAGTTAGCTAGAGAAGCCTGGG - Intronic
909963881 1:81883070-81883092 GCAGTTGGTTTGTGAAACCCAGG + Intronic
910098656 1:83552946-83552968 GCACTTTGGTAGTGGAGCCAGGG + Intergenic
913347445 1:117822274-117822296 GTAGGTTGAGAGTGAATCCCTGG + Intergenic
915147035 1:153801418-153801440 GCACTTTGGTGGAGAAGCCCAGG - Intergenic
915228539 1:154429009-154429031 GCAGCTGGATGGTGAAGACCAGG + Intronic
916966502 1:169949869-169949891 GCAGTTGGACAGTGAATCCTGGG - Intronic
920876443 1:209840616-209840638 GCAGTTTGATAGTGACGGAAAGG + Intronic
921182766 1:212644618-212644640 GCAGTTGGATGATGAGGCCCTGG - Intergenic
921523658 1:216189862-216189884 ACAGGTTGGTAGTTAAGCCCTGG + Intronic
923096336 1:230778101-230778123 GCAGTTTGAGAGAGAAGCTCAGG - Intronic
1062958443 10:1555568-1555590 ACAGTTTCTTAATGAAGCCCCGG - Intronic
1065044083 10:21730015-21730037 GCAGTTAGATAGAGAGGCCTGGG + Intronic
1067742437 10:48905778-48905800 TCAGCTTGATCCTGAAGCCCGGG - Intronic
1068317422 10:55364523-55364545 GCAGTTTTATTGTGATGCCATGG + Intronic
1068966661 10:62918570-62918592 GCAGTATTGAAGTGAAGCCCGGG - Intronic
1069159314 10:65072761-65072783 GCAGGATGAGAGTGAAGCCAAGG - Intergenic
1069656410 10:70092492-70092514 GCATTTTGTTAGAGCAGCCCAGG + Intronic
1069660199 10:70118387-70118409 GCAATTTGATACCAAAGCCCAGG - Intronic
1070749978 10:78958339-78958361 GCAGTCAGATACTGAAACCCAGG + Intergenic
1072569621 10:96647233-96647255 CTAGTTTGATACTGAAGCCCGGG - Intronic
1074273886 10:111982642-111982664 GGAGTTGAAGAGTGAAGCCCTGG + Intergenic
1079006263 11:16793459-16793481 GCAGGTAGATGGTGAAGACCAGG + Intronic
1080497862 11:32838263-32838285 GGAGTTTCATCGTGAAGCCCAGG - Intronic
1081655381 11:44853780-44853802 TCAGTTTCCAAGTGAAGCCCTGG - Intronic
1082106045 11:48222897-48222919 GGGGTTTGAAAATGAAGCCCTGG - Intergenic
1083903368 11:65654683-65654705 GCAGTTTGATGATGAAGACCTGG - Exonic
1093856624 12:24112096-24112118 GCACTTTGATAGCGAAGCCATGG - Intergenic
1098572429 12:72003617-72003639 GAACTTTGATATTGTAGCCCAGG + Intronic
1104848417 12:131858698-131858720 GCGGTTTGATGGTGATGGCCTGG + Intergenic
1105658136 13:22462896-22462918 GCAGTTCAAAAGTGAGGCCCAGG - Intergenic
1107420621 13:40242875-40242897 TGAGTTTTGTAGTGAAGCCCAGG - Intergenic
1113979345 13:114260504-114260526 GCAGTTTTAGCGTGATGCCCAGG + Intronic
1114473578 14:22979878-22979900 GCAGTTTCATTTTGAGGCCCAGG - Intronic
1116656686 14:47662659-47662681 GATGTTTGATAGTGAGGCACAGG + Intronic
1122123230 14:99565669-99565691 GCAGGTGGATACAGAAGCCCGGG + Intronic
1122954523 14:105064357-105064379 CCAATTTGATAGTGTTGCCCAGG + Intronic
1123456096 15:20427546-20427568 GCAGGTGCATAGTGCAGCCCTGG - Intergenic
1123635473 15:22303291-22303313 GCAGGTGCATAGTGCAGCCCTGG + Intergenic
1125992750 15:44125883-44125905 GCACATTGACAGGGAAGCCCAGG + Intronic
1126416750 15:48425625-48425647 GCAGTTTCATAGGAAAGCACAGG - Intronic
1129955556 15:79633677-79633699 GATCTTTGATATTGAAGCCCAGG - Intergenic
1130733424 15:86523087-86523109 GCAGTTTGGTACAGCAGCCCAGG - Intronic
1132026716 15:98410029-98410051 TCTCTTTGATAGTGGAGCCCAGG - Intergenic
1133530051 16:6646980-6647002 GCAGTTTGTTAGGGTAGCCCAGG - Intronic
1146485834 17:33241794-33241816 CCAGCTTGGTTGTGAAGCCCAGG - Intronic
1151410591 17:73924963-73924985 GTATTTTGTTAGGGAAGCCCTGG + Intergenic
1156369614 18:36461015-36461037 GCAGGTTGAGAGTGGAGCACAGG + Intronic
1160195326 18:76749952-76749974 GGAGTTTCATACTGAAGCCCAGG + Intergenic
1164892607 19:31837648-31837670 GCAGTCTGATTCTGAAGACCTGG + Intergenic
1165739339 19:38196160-38196182 GCACTTGGTTAGTGAAGCCCAGG - Intronic
1166210947 19:41306254-41306276 GCAGTTAGGGACTGAAGCCCAGG - Intronic
1166920354 19:46225018-46225040 GCAGCTTCACAGGGAAGCCCTGG - Intergenic
1168319052 19:55498111-55498133 GCAGTCGGACAGTGAAGCCTCGG - Exonic
928620747 2:33085292-33085314 GCAATTTGTTAGAGCAGCCCTGG + Intronic
932049676 2:68386192-68386214 GCAGTAGGATAGTTGAGCCCAGG - Intronic
934111652 2:88748978-88749000 GCACTTTGGGAATGAAGCCCAGG - Intronic
935431059 2:102976226-102976248 GCAGTTTGCCTGTGAAGCACTGG - Intergenic
937239844 2:120453019-120453041 GCAGCAAGAGAGTGAAGCCCTGG + Intergenic
937539467 2:122930640-122930662 GCAGATTGATAGTGATGCTCAGG + Intergenic
940710173 2:157153625-157153647 GCAGTAAGATAATGAAGACCTGG - Intergenic
947186582 2:227460755-227460777 ACAGTTTGTTACAGAAGCCCTGG - Intergenic
1173181388 20:40809024-40809046 GCAGGTTGATGGTCATGCCCAGG + Intergenic
1174079373 20:47960211-47960233 GGAATTTGATGGTGAAGCCTGGG - Intergenic
1179093509 21:38290552-38290574 GGAGTTTGCTAGTGATGCCTTGG - Intronic
1179722653 21:43324379-43324401 GCACTTTGCTAGGGAAGCCCAGG - Intergenic
1181556389 22:23674050-23674072 GCAGTTGGATAGAGAACCCAGGG + Intergenic
1183425534 22:37737212-37737234 TCAGTTTCATGGTGAAGCTCAGG + Intronic
1185330325 22:50249339-50249361 GCAGGTTGACAGTGAAGCCGAGG + Exonic
951211486 3:19980082-19980104 GCAGTTTGCTAGGGAAGTGCTGG + Intronic
951348557 3:21576570-21576592 GCAATTTGTCAGTTAAGCCCTGG + Intronic
952632583 3:35487418-35487440 GTAGTTTGTTACAGAAGCCCTGG - Intergenic
952833056 3:37581400-37581422 ACTGTTTGACAGTGTAGCCCAGG + Intronic
960510964 3:118548426-118548448 GCACTCTGATATTGAAGCCCGGG + Intergenic
962412171 3:135150892-135150914 GCAGTTTGAGAGGAGAGCCCAGG - Intronic
963605757 3:147410542-147410564 GCAGCCTGCTCGTGAAGCCCGGG - Exonic
965292260 3:166898583-166898605 TAAGTGTGATAGGGAAGCCCTGG + Intergenic
971351716 4:25862277-25862299 GAAGATTGAGAGGGAAGCCCAGG + Intronic
971585477 4:28400646-28400668 GCAGTTTGATAGTGAAGCCCTGG + Intronic
973613362 4:52657989-52658011 GAAGCTTGATGGAGAAGCCCTGG - Intronic
974656534 4:64830943-64830965 GCAGTTTGTTACAGCAGCCCTGG - Intergenic
978548657 4:109900598-109900620 GTAGTTTGGTAGTGAAGGCAAGG + Intergenic
983098478 4:163595157-163595179 TCAGTTTGAGAGTGAAGCTACGG + Intronic
983426089 4:167584662-167584684 GCAGTTTGACACAGAAGTCCAGG - Intergenic
984761257 4:183364755-183364777 GAAGTTTGATGGTGACCCCCAGG + Intergenic
985853809 5:2409666-2409688 GCAGGGTTATAGTGAAGCTCAGG - Intergenic
987017600 5:13836287-13836309 GGAGTTTGGGAGAGAAGCCCTGG + Intronic
991354621 5:65754911-65754933 GCAGGTTGATGGTGGATCCCGGG - Intronic
992752118 5:79871339-79871361 GCAGTTTGTGAGTGGATCCCAGG + Intergenic
995068555 5:107890796-107890818 GTATTTTGATAGTGAAGCAAAGG + Intronic
996404492 5:123092068-123092090 GAAGTTTGAGAGTAAAGCACTGG + Intronic
998038980 5:138938981-138939003 GGAGTTGGTTAGAGAAGCCCAGG + Intergenic
998349171 5:141489834-141489856 GCAGCTGGATCGTGAAGCCCAGG + Exonic
1001012087 5:168107787-168107809 GCAGTTTGATAGGAAAGGCTGGG - Intronic
1001374343 5:171241206-171241228 GAAGTGTTATAATGAAGCCCAGG + Intronic
1015969205 6:138727566-138727588 GCAGTTGGATGCTTAAGCCCAGG + Intergenic
1020985993 7:15134784-15134806 GCAGTTTGATAGTGAAATTGGGG + Intergenic
1021820506 7:24493441-24493463 GAAGTTTTATAATGAAACCCAGG + Intergenic
1023721084 7:43095507-43095529 GCAGGCTGAGAGTGAAGCCAGGG + Intergenic
1024184741 7:46938761-46938783 GAAGTTTGAAAGTAAAGCTCAGG + Intergenic
1031528501 7:122850037-122850059 GCAGTTTGATGATGAAGACCTGG + Intronic
1033261872 7:139850995-139851017 GCAATTTGTTAGAGAAGCCCTGG + Intronic
1037897042 8:22664560-22664582 GCAGGTTGGTAGTGAATCACAGG - Intronic
1040829257 8:51659713-51659735 GCAGAGTGATAGAAAAGCCCAGG + Intronic
1041548031 8:59068749-59068771 GCAGGTTGATTGTGGAGCCTAGG + Intronic
1042916428 8:73879517-73879539 GCAGTTTAAAAGTGAAGGGCGGG - Intergenic
1043428062 8:80168569-80168591 ACAGTTTGCTAGTGAACACCAGG + Intronic
1043980250 8:86629935-86629957 GGAGTGTGAAAGTGAGGCCCTGG - Intronic
1049415987 8:142495422-142495444 GCAGTTTGTTAGGGCAGCCCTGG - Intronic
1056473287 9:86926737-86926759 GCAGGTTGATATTGAACTCCTGG + Intergenic
1056879764 9:90379991-90380013 GCAGTCAGATAGTGGAGCCCTGG + Intergenic
1058353980 9:104060753-104060775 GGAGTTAGCTAGTGAAGCCAGGG - Intergenic
1059454542 9:114391342-114391364 CCAATTTTATAGTGAGGCCCTGG + Intronic
1060907069 9:127316232-127316254 GCAGTTTTAAAGAGAAGCCAAGG - Intronic
1190443193 X:50496137-50496159 GCTTTTTGAGAGTGAAGCTCTGG + Intergenic
1192959310 X:76110476-76110498 GCAGTTTAAGAGTGAAGTCCTGG - Intergenic
1195466810 X:105188465-105188487 GCATTCTGAAAGTGAAGCCATGG - Intronic