ID: 971588733

View in Genome Browser
Species Human (GRCh38)
Location 4:28439391-28439413
Sequence ATGTCATATTTTAAGTTGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971588733_971588735 -2 Left 971588733 4:28439391-28439413 CCAACCAACTTAAAATATGACAT No data
Right 971588735 4:28439412-28439434 ATTTATTCTTGTTTTCTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971588733 Original CRISPR ATGTCATATTTTAAGTTGGT TGG (reversed) Intergenic
No off target data available for this crispr