ID: 971595589

View in Genome Browser
Species Human (GRCh38)
Location 4:28523971-28523993
Sequence TCAACCTGGAGGAGAACAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971595586_971595589 16 Left 971595586 4:28523932-28523954 CCTCAATTCAAATTTCATAACAA No data
Right 971595589 4:28523971-28523993 TCAACCTGGAGGAGAACAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971595589 Original CRISPR TCAACCTGGAGGAGAACAGA TGG Intergenic
No off target data available for this crispr