ID: 971606250

View in Genome Browser
Species Human (GRCh38)
Location 4:28661618-28661640
Sequence CTGTATCCCCAGAGGGGAGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971606250_971606256 20 Left 971606250 4:28661618-28661640 CCTACTCCCCTCTGGGGATACAG No data
Right 971606256 4:28661661-28661683 ACACTCTTTTTGACAGCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971606250 Original CRISPR CTGTATCCCCAGAGGGGAGT AGG (reversed) Intergenic
No off target data available for this crispr