ID: 971612100

View in Genome Browser
Species Human (GRCh38)
Location 4:28738658-28738680
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971612100_971612108 27 Left 971612100 4:28738658-28738680 CCTCCCTTAAGTGAAGTCCACAA No data
Right 971612108 4:28738708-28738730 CAAGAACTACACTATATCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971612100 Original CRISPR TTGTGGACTTCACTTAAGGG AGG (reversed) Intergenic
No off target data available for this crispr