ID: 971612366

View in Genome Browser
Species Human (GRCh38)
Location 4:28742120-28742142
Sequence ATGAAAATAAATGAGCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971612366_971612371 19 Left 971612366 4:28742120-28742142 CCTTCCTGCTCATTTATTTTCAT No data
Right 971612371 4:28742162-28742184 GGATTACTCATTTATTTAACCGG No data
971612366_971612369 -2 Left 971612366 4:28742120-28742142 CCTTCCTGCTCATTTATTTTCAT No data
Right 971612369 4:28742141-28742163 ATGCCTATAACTGGTGTTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971612366 Original CRISPR ATGAAAATAAATGAGCAGGA AGG (reversed) Intergenic
No off target data available for this crispr