ID: 971615320

View in Genome Browser
Species Human (GRCh38)
Location 4:28781914-28781936
Sequence GTAGCATTGTGTCCAAAACA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971615320_971615321 3 Left 971615320 4:28781914-28781936 CCTTGTTTTGGACACAATGCTAC No data
Right 971615321 4:28781940-28781962 TAAAAGAGATAATTGTAGAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971615320 Original CRISPR GTAGCATTGTGTCCAAAACA AGG (reversed) Intergenic
No off target data available for this crispr