ID: 971615573

View in Genome Browser
Species Human (GRCh38)
Location 4:28786567-28786589
Sequence CTGCAGACAGAGGTGGAGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
971615569_971615573 -1 Left 971615569 4:28786545-28786567 CCTAAAGCAGATTAGTTATCAAC No data
Right 971615573 4:28786567-28786589 CTGCAGACAGAGGTGGAGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
971615573 Original CRISPR CTGCAGACAGAGGTGGAGGA AGG Intergenic
No off target data available for this crispr